KEGG   Natrialba magadii: Nmag_0704Help
Entry
Nmag_0704         CDS       T01176                                 

Definition
(GenBank) aspartate-rich protein
Organism
nmg  Natrialba magadii
SSDB OrthologParalogGene clusterGFIT
Motif
Pfam: TAT_signal
Motif
Other DBs
NCBI-ProteinID: ADD04289
UniProt: D3SZF5
Position
complement(702633..702998)
Genome map
AA seq 121 aa AA seqDB search
MDDRLTRRRLIAISGAVSAAALAGCNDDPEDPDDPADPDDDPVDDDEMDDDDMDDEDDEM
DDDEMDDEDDDIDDDEDDDMDDEDDDMDDEDDDVDDDEDDDDDDDDDMDDDDDDDDDNDD
A
NT seq 366 nt NT seq  +upstreamnt  +downstreamnt
atggacgaccgactcacacgccgacgactgatcgcaatcagtggtgccgtgagcgccgct
gcgctcgcgggatgtaacgatgatccagaggatcctgatgatccggctgatccggacgac
gatccagttgatgacgatgagatggacgatgacgatatggacgacgaggatgacgagatg
gacgatgacgagatggatgatgaggacgacgacatagatgatgacgaagatgacgacatg
gatgacgaagacgacgacatggatgatgaagatgacgacgtagatgacgacgaagacgac
gatgacgacgatgacgacgatatggatgacgacgacgatgacgacgacgacaacgacgac
gcctaa

DBGET integrated database retrieval system