KEGG   Natrialba magadii: Nmag_R0014Help
Entry
Nmag_R0014        tRNA      T01176                                 

Definition
(GenBank) tRNA-Leu
  KO
K14228  tRNA Leu
Organism
nmg  Natrialba magadii
Pathway
nmg00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:nmg00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    Nmag_R0014
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:nmg03100]
    Nmag_R0014
Non-coding RNAs [BR:nmg03100]
 Transfer RNA
  tRNA
   Nmag_R0014
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Position
680595..680677
Genome map
NT seq 83 nt NT seq  +upstreamnt  +downstreamnt
gcgagggtagccaagcggccaacggcggcggactcaagatccgctcgtgtagacgttcgt
gggttcgattccctcccctcgca

DBGET integrated database retrieval system