KEGG   Nostoc sp. PCC 7107: Nos7107_5367Help
Entry
Nos7107_5367      CDS       T02362                                 

Definition
(GenBank) acyl-CoA-dehydrogenase, peroxisomal
Organism
nos  Nostoc sp. PCC 7107
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-ProteinID: AFY45852
UniProt: K9QM41
Position
complement(6237064..6237201)
Genome map
AA seq 45 aa AA seqDB search
MLPELEKGLKFCCLGLPGKNAGSDQLGIWLISCCKENEAFATVFT
NT seq 138 nt NT seq  +upstreamnt  +downstreamnt
atgcttcctgaactggaaaaaggcttgaaattttgctgcttgggacttcctggcaaaaat
gctggaagtgaccagttgggtatctggttaattagttgctgcaaagaaaacgaagccttt
gccacagtatttacctaa

DBGET integrated database retrieval system