KEGG   Nostoc sp. PCC 7107: Nos7107_R0092Help
Entry
Nos7107_R0092     tRNA      T02362                                 

Definition
(GenBank) tRNA-Met
  KO
K14230  tRNA Met
Organism
nos  Nostoc sp. PCC 7107
Pathway
nos00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:nos00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    Nos7107_R0092
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:nos03100]
    Nos7107_R0092
Non-coding RNAs [BR:nos03100]
 Transfer RNA
  tRNA
   Nos7107_R0092
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Position
complement(6259294..6259368)
Genome map
NT seq 75 nt NT seq  +upstreamnt  +downstreamnt
tgaaagttagctcactggtagagcaatcgactcataatcgatgtgttgcaggttcaattc
ctgtactttctccca

DBGET integrated database retrieval system