KEGG   Nitrosococcus watsonii: Nwat_R0005Help
Entry
Nwat_R0005        ncRNA     T01266                                 

Gene name
rnpB
Definition
(GenBank) RNA component of RNaseP
  KO
K01978  M1 RNA
Organism
nwa  Nitrosococcus watsonii
Brite
KEGG Orthology (KO) [BR:nwa00001]
 09180 Brite Hierarchies
  09182 Protein families: genetic information processing
   03016 Transfer RNA biogenesis [BR:nwa03016]
    Nwat_R0005 (rnpB)
  09184 RNA family
   03100 Non-coding RNAs [BR:nwa03100]
    Nwat_R0005 (rnpB)
Transfer RNA biogenesis [BR:nwa03016]
 Prokaryotic Type
  5'processing factors
   Ribonucrease P
    Nwat_R0005 (rnpB)
Non-coding RNAs [BR:nwa03100]
 Other RNA
  Ribonuclease P
   Nwat_R0005 (rnpB)
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Position
224446..224742
Genome map
NT seq 297 nt NT seq  +upstreamnt  +downstreamnt
gaggaaagtccgggctccatagggcagggtgccaggtaacacctggggggcgcgagccta
tggaaagtgccgcagaaaatataccgcctaagcgtcagcggacgccggtaagggtgaaat
ggtgcggtaagagcgcaccgcacgggtggcaacacaccgtggcagggtaaaccccacccg
gagcaaggccaaatagaggaacaagggtgtagcccgcaccgttcctgggtaggctgcttg
agatgcatggtgacatgcatcctagatgaatggctgtccatgacagaacccggctta

DBGET integrated database retrieval system