KEGG   Nitrosococcus watsonii: Nwat_R0006Help
Entry
Nwat_R0006        tRNA      T01266                                 

Definition
(GenBank) tRNA-Gln
  KO
K14223  tRNA Gln
Organism
nwa  Nitrosococcus watsonii
Pathway
nwa00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:nwa00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    Nwat_R0006
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:nwa03100]
    Nwat_R0006
Non-coding RNAs [BR:nwa03100]
 Transfer RNA
  tRNA
   Nwat_R0006
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Position
complement(262029..262102)
Genome map
NT seq 74 nt NT seq  +upstreamnt  +downstreamnt
tgggggatcgtctagtggtaggacagcggactctgactccgtcaacctaggttcgaatcc
tagtcccccagcca

DBGET integrated database retrieval system