KEGG   Nitrobacter winogradskyi: Nwi_1497Help
Entry
Nwi_1497          CDS       T00276                                 

Definition
(GenBank) hypothetical protein
Organism
nwi  Nitrobacter winogradskyi
SSDB OrthologParalogGene clusterGFIT
Motif
Pfam: PsbI
Motif
Other DBs
NCBI-ProteinID: ABA04758
UniProt: Q3SSI3
Position
1627507..1627755
Genome map
AA seq 82 aa AA seqDB search
MVRHLAPERASANIVFAVVRDLPLRVTAQDLAMSKFALLLLEARTYAPLDVWRDHRLRCA
LLCQLSLRTISPSDPGRNPGRG
NT seq 249 nt NT seq  +upstreamnt  +downstreamnt
ttggttcggcatctcgcgccggagcgtgcgagcgccaatattgtctttgctgttgtccgc
gatttaccgttgcgggtaacggcgcaggatcttgcgatgagcaagtttgctttgttgctg
ttggaggcaagaacatatgcccctcttgatgtttggcgcgatcatcggctgcggtgtgct
cttttatgccagctatcgctacgtacgatctcaccctccgatccgggaagaaatccggga
agaggatga

DBGET integrated database retrieval system