KEGG   Nitrobacter winogradskyi: Nwi_R0028Help
Entry
Nwi_R0028         tRNA      T00276                                 

Definition
(GenBank) tRNA-Arg
  KO
K14219  tRNA Arg
Organism
nwi  Nitrobacter winogradskyi
Pathway
nwi00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:nwi00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    Nwi_R0028
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:nwi03100]
    Nwi_R0028
Non-coding RNAs [BR:nwi03100]
 Transfer RNA
  tRNA
   Nwi_R0028
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Position
1682382..1682458
Genome map
NT seq 77 nt NT seq  +upstreamnt  +downstreamnt
ggtcccgtagctcaactggatagagtagcggatttctactccgcgggttgcaggttcgaa
tcctgccgggatcgcca

DBGET integrated database retrieval system