KEGG   Olsenella uli: Olsu_0106Help
Entry
Olsu_0106         CDS       T01285                                 

Definition
(GenBank) triosephosphate isomerase
  KO
K01803  triosephosphate isomerase (TIM) [EC:5.3.1.1]
Organism
ols  Olsenella uli
Pathway
ols00010  Glycolysis / Gluconeogenesis
ols00051  Fructose and mannose metabolism
ols00562  Inositol phosphate metabolism
ols01100  Metabolic pathways
ols01110  Biosynthesis of secondary metabolites
ols01120  Microbial metabolism in diverse environments
ols01130  Biosynthesis of antibiotics
ols01200  Carbon metabolism
ols01230  Biosynthesis of amino acids
Module
ols_M00002  Glycolysis, core module involving three-carbon compounds
ols_M00003  Gluconeogenesis, oxaloacetate => fructose-6P
Brite
KEGG Orthology (KO) [BR:ols00001]
 Metabolism
  Carbohydrate metabolism
   00010 Glycolysis / Gluconeogenesis
    Olsu_0106
   00051 Fructose and mannose metabolism
    Olsu_0106
   00562 Inositol phosphate metabolism
    Olsu_0106
Enzymes [BR:ols01000]
 5. Isomerases
  5.3  Intramolecular oxidoreductases
   5.3.1  Interconverting aldoses and ketoses, and related compounds
    5.3.1.1  triose-phosphate isomerase
     Olsu_0106
Exosome [BR:ols04147]
 Exosomal proteins
  Exosomal proteins of colorectal cancer cells
   Olsu_0106
  Exosomal proteins of bladder cancer cells
   Olsu_0106
  Exosomal proteins of melanoma cells
   Olsu_0106
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-ProteinID: ADK67238
UniProt: E1QXX4
Position
120783..121493
Genome map
AA seq 236 aa AA seqDB search
MDKIVLRRPFFVVNPKSYLYGEKLRRLARKTDGLCERYGFQSLFTAQLIDLAWVADNCPH
LIPCAQAMESLRPGRGMGHVLPEALAAAGVRATFLNHAENPMTVGELARTVARAREVGIL
TCVCADSVEEAKAIAELHPDIMTCEPNSLIGTGRIAGGDYIRASTEAVKSVSPGTMVLQA
AGISTGQDVYDAIHYGGDATGGTSGIVCAGDPEAKLEEMFEALGRVRADIQGEARP
NT seq 711 nt NT seq  +upstreamnt  +downstreamnt
atggacaagattgttctcaggcgcccgtttttcgtcgtcaaccccaagtcctacctgtac
ggagagaagctccgcaggctcgctcgcaagacggatgggctctgcgagcgttacggcttc
cagtccctgttcaccgcacagctcatcgatctcgcttgggttgcggacaactgcccgcat
ctcatcccgtgcgctcaggccatggagagcctcaggcccggccgcggcatggggcacgtc
ctcccggaggcgctcgccgccgcaggggtgcgcgcaacgttcctcaaccacgccgagaac
cccatgacggtgggcgagctcgccaggaccgtcgcgcgtgcccgcgaggtgggcatcctc
acctgcgtgtgcgccgactccgtcgaggaggccaaggccatcgccgagctccaccccgac
atcatgacgtgcgagcccaacagcctcatcggcaccggccgcatcgccggcggggactac
atccgcgcctccaccgaggccgtcaagtccgtctcgcccgggacaatggtcctgcaggcc
gccggcatctccaccggccaggacgtctatgacgccatccactacggcggcgacgccacg
ggcggcacctcgggcatcgtctgcgcgggggaccccgaggcgaagctcgaggagatgttc
gaggcgctcggccgcgtccgcgccgacatccagggggaggcccggccatga

DBGET integrated database retrieval system