KEGG   Pseudomonas aeruginosa LES431: T223_11160Help
Entry
T223_11160        tRNA      T02970                                 

Definition
(GenBank) tRNA-Ser
  KO
K14233  tRNA Ser
Organism
pael  Pseudomonas aeruginosa LES431
Pathway
pael00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:pael00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    T223_11160
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:pael03100]
    T223_11160
Non-coding RNAs [BR:pael03100]
 Transfer RNA
  T223_11160
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Position
complement(2346446..2346535)
Genome map
NT seq 90 nt NT seq  +upstreamnt  +downstreamnt
ggtgaggtgtccgagtggttgaaggagcacgcctggaaagtgtgtatacgggaaaccgta
tcgagggttcgaatccctccctcaccgcca

DBGET integrated database retrieval system