KEGG   Pantoea ananatis AJ13355: PAJ_t0028
Entry
PAJ_t0028         tRNA      T01969                                 

Definition
(GenBank) tRNA-Asn
  KO
K14220  tRNA Asn
Organism
paj  Pantoea ananatis AJ13355
Pathway
paj00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:paj00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    PAJ_t0028
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:paj03100]
    PAJ_t0028
Non-coding RNAs [BR:paj03100]
 Transfer RNA
  PAJ_t0028
SSDB
Position
2089292..2089367
NT seq 76 nt   +upstreamnt  +downstreamnt
tcctctgtagttcagtcggtagaacggcggactgttaatccgtatgtcactggttcgagt
ccagtcagaggagcca

DBGET integrated database retrieval system