KEGG   Pantoea sp. At-9b: Pat9b_4127Help
Entry
Pat9b_4127        CDS       T01386                                 

Definition
(GenBank) conserved hypothetical protein
Organism
pao  Pantoea sp. At-9b
SSDB OrthologParalogGene clusterGFIT
Motif
Pfam: Gly-zipper_OmpA Gly-zipper_Omp Rick_17kDa_Anti Gly-zipper_YMGG Bacteriocin_IIc YjbE DUF1269 TraT
Motif
Other DBs
NCBI-ProteinID: ADU72691
UniProt: E6WMQ6
Position
pPAT9B04:complement(742..951)
Genome map
AA seq 69 aa AA seqDB search
MRKLSMLVVTLGLLLSVTSEAQAAGCLKGAAAGAAVGHLKHHAVIGAAVGCVVGHHLANK
KQANAAEKH
NT seq 210 nt NT seq  +upstreamnt  +downstreamnt
atgcgtaagctttcgatgctggtcgtcacgttgggcctgttgttgtctgttacctccgag
gcgcaggctgcgggctgtctgaaaggcgccgcggctggcgcagcggtcgggcatctcaag
catcatgctgtgattggtgctgcggtaggttgtgtagtgggtcatcatctggccaacaag
aagcaggcaaacgcggcagaaaaacattga

DBGET integrated database retrieval system