KEGG   Pyrolobus fumarii: Pyrfu_0122Help
Entry
Pyrfu_0122        CDS       T01620                                 

Definition
(GenBank) hypothetical protein
Organism
pfm  Pyrolobus fumarii
SSDB OrthologParalogGene clusterGFIT
Motif
Pfam: zf-C2HC5 zinc-ribbons_6 DZR zinc_ribbon_10 DUF1272 C1_2 Zn_ribbon_SprT HypA zinc_ribbon_2 zf-ribbon_3
Motif
Other DBs
NCBI-ProteinID: AEM37994
UniProt: G0EEF3
Position
112268..112510
Genome map
AA seq 80 aa AA seqDB search
MSTAGLKGINAFGHLGWITRKCRICALKIDITRDLHYVCTHCKDKYDAYFCPADAKRLHY
RCPFCGRELVPVNAALYQPR
NT seq 243 nt NT seq  +upstreamnt  +downstreamnt
gtgtctacagctggcttgaagggcatcaacgcgtttggccatttaggctggattaccagg
aagtgtagaatatgcgccctcaagatagacataactagggatctacactacgtatgcaca
cattgtaaggacaaatacgatgcctacttctgtcctgctgatgcaaagagactacattac
cgctgcccattctgtggtagagagctagtgcctgtcaatgccgccctttatcagccacgc
tga

DBGET integrated database retrieval system