KEGG   Prochlorococcus marinus NATL1A: NATL1_tRNA1309186Help
Entry
NATL1_tRNA1309186 tRNA      T00467                                 

Definition
(GenBank) tRNA-Val
  KO
K14237  tRNA Val
Organism
pme  Prochlorococcus marinus NATL1A
Pathway
pme00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:pme00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    NATL1_tRNA1309186
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:pme03100]
    NATL1_tRNA1309186
Non-coding RNAs [BR:pme03100]
 Transfer RNA
  NATL1_tRNA1309186
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
CyanoBase: NATL1_tRNAValVIMSS1309186
Position
complement(1813936..1814007)
Genome map
NT seq 72 nt NT seq  +upstreamnt  +downstreamnt
gggcgattagctcagcggtagagcgcctgccttacaagcaggatgtccctggttcgaacc
ctggatcgccca

DBGET integrated database retrieval system