KEGG   Pasteurella multocida 36950: Pmu_01730Help
Entry
Pmu_01730         gene      T01729                                 

Definition
(GenBank) pseudogene
Organism
pmp  Pasteurella multocida 36950
SSDB OrthologParalogGene clusterGFIT
Position
complement(181284..181987)
Genome map
NT seq 704 nt NT seq  +upstreamnt  +downstreamnt
atgacaaaacaagttagaattgttgtcttaaccggtgctggcatttcagccgaatcgggt
attcgcactttccgagctactgatggcttatgggagaatcatcctgttgatgaggttgct
accccagaaggctttgctcgcaaccccaaactcgtgcagcgcttttacaatgaacgccgt
aagcagttattttctgatcagattgcacccaatgctgcccatttcgccttagcggaactg
gaaaaaaactcggcgataatttactcatcgtcacacaaaatgtagataatttacacgaac
gtgcggggtcaaaaaacttgattcatatgcatggggaattattgaaagttcgctgtgtcg
aatcaggaaaaatttatgactgacaaggagatattggtgagcacgacaagtgtctttgct
gtacacctactcagattctacgcccgcatattgtatggtttggcgaagtgccgttagaaa
tggaaaaaattcagaccgcactttctgagtgtgattattttatttcaattggaacgtctg
gcaatgtttatcccgcagcagggtttgtacgcgaagcgctgttttatggggctcacacag
tcgagcttaatttagaacctagccaagtgcggtctagttttgacgaatgtcattatggta
aagcgacggaattggttccacactatttagcacaatttctttaa

DBGET integrated database retrieval system