KEGG   Pasteurella multocida 36950: Pmu_02470Help
Entry
Pmu_02470         tRNA      T01729                                 

Definition
(GenBank) tRNA-Met
  KO
K14230  tRNA Met
Organism
pmp  Pasteurella multocida 36950
Pathway
pmp00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:pmp00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    Pmu_02470
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:pmp03100]
    Pmu_02470
Non-coding RNAs [BR:pmp03100]
 Transfer RNA
  tRNA
   Pmu_02470
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Position
complement(252316..252391)
Genome map
NT seq 76 nt NT seq  +upstreamnt  +downstreamnt
cgcggggtggagcagcttggtagctcgtcgggctcataacccgaaggtcgtcggttcaaa
tccggccccgcaacca

DBGET integrated database retrieval system