KEGG   Paenibacillus mucilaginosus 3016: PM3016_1803Help
Entry
PM3016_1803       CDS       T01757                                 

Definition
(GenBank) hypothetical protein
Organism
pmq  Paenibacillus mucilaginosus 3016
SSDB OrthologParalogGene clusterGFIT
Motif
Pfam: Collagen
Motif
Other DBs
NCBI-ProteinID: AFC28713
UniProt: H6NH35
Position
complement(2046862..2047152)
Genome map
AA seq 96 aa AA seqDB search
MDITTDIIMGIMGITGITGITGITGITGITGITGIMGIMGIMGIMDIMADITAATMAAGS
TDITATDASKAATKRGKPAGRSDRPAFCPAPPFTSR
NT seq 291 nt NT seq  +upstreamnt  +downstreamnt
atggacatcaccacggacatcatcatgggcatcatgggcatcacgggcatcacgggcatc
acgggcatcacgggcatcacgggcatcacgggcatcacgggcatcatgggcatcatgggc
atcatgggcatcatggacatcatggcggacatcacggcggccaccatggcggcgggcagc
acggacatcacggccacggacgcctccaaggccgcgactaagcgcgggaagccggccggc
cgctcggaccggccggctttctgcccggctcccccatttacttcacgatga

DBGET integrated database retrieval system