KEGG   Polaromonas sp. JS666: Bpro_R0035Help
Entry
Bpro_R0035        tRNA      T00343                                 

Definition
(GenBank) tRNA-Pro
  KO
K14232  tRNA Pro
Organism
pol  Polaromonas sp. JS666
Pathway
pol00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:pol00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    Bpro_R0035
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:pol03100]
    Bpro_R0035
Non-coding RNAs [BR:pol03100]
 Transfer RNA
  tRNA
   Bpro_R0035
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Position
complement(3136151..3136227)
Genome map
NT seq 77 nt NT seq  +upstreamnt  +downstreamnt
cggagtgtggcgcagtctggtagcgcacctggtttgggaccagggggtccaaggttcgaa
tccttgtactccgacca

DBGET integrated database retrieval system