KEGG   Pseudoalteromonas sp. SM9913: PSM_B0335
Entry
PSM_B0335         gene      T01374                                 

Definition
(GenBank) pseudogene
Organism
psm  Pseudoalteromonas sp. SM9913
SSDB
Position
II:complement(378942..383440)
NT seq 4499 nt   +upstreamnt  +downstreamnt
ttgagtaagtttttctttattgtttatatgtttttatttgtttgctcgcagcatagcttt
gcttcacaaacttattcagaacaattacaacgtatcactaacaacgaacaattgtcgcaa
agctttatagtgaaatcactccaagatgacatgagctatgtatggattgctacaactgaa
ggtttataccgattcgacggataccaagtcacgccttacgagagcgaattgggtttaaaa
aataactacattaatagtatttataaagcaattgacggccaaattctggttaatactcaa
cttgcaggaagttatttgattaaccctaataccttgcaagcagagctaatatattcaggg
cacttaaaccaaaatcaagaaaagttctctcctgttcaggctgttgctgaacaaccggcg
catttttatttttctattgattcgcacatctaccgatatggtaaaacatcaaaagaccta
acactcatctcatctttgcccgatgaaaatatgtttattagagcattatcattataccaa
aacacattgtatattggtgccgatcaggggctatatgtttataactttgccaataacgac
ctacaacaaataacacttaacgacattcaagaagttacaaacgatagcaacaatgttaaa
tttttatccatagatgatgagcttggtttgctagttggtacggttgaaggaatgtatcgg
attgcttttgatgaaattaaaaatataaacccttcagcattaacaactttgataagtgac
tataatatttgggattatataaacacaccgtatggtgagtttattgccacagaaagtggg
ttatttgaattcgatagaaaaaacacaagcattagccctattttaaacttcaaagatagt
aactacaacgtaacagagaacacaataaacgatattatgtttgatgagtcgggcttactt
tggttaggttctagaacacatggaatatttacttgggcagcacaaacaaaaaagtttaaa
aaaataaccttacctgaaaataatattgtaaacactatttaccaagataatagtaaatta
ctgtggataggcactgacgatggacttgttcagtataacttagaaacccaaaagagtgac
ttatatctacaatctaaagatagcaaagcggtctatggcctatcggctataggtgatatt
ttccctgcatatggcaaaggcgataactacctatggctagcaactttttccgggctcgat
ctctttaataaagaaacaacaacatttgaaaaaaacaaatacattactcagtacaagtta
aataccgactatacgttcggcattgcacaagttgcacccgatacttttgcttatattaac
aatgataacttttatatatttaatggtaatacaggcgaaaaccgagttattaatggacta
aaagagcaggtatcgcccatgcttgcatatacgtttcataccccctctgaggctttccct
ggcgaattactgttaagtacctctgacacactttatcgatacaacgaagaaacagagact
ttaattactatttttgaatctaaaacagcaaaaaacaatctttaccatacagtagagaat
tattattacgatgctaagcgagggctgctgtggttagccaccacccaagaaggcttaatt
gcagtaaacgctaaaacatatcagcaagtgcatgtatttgataaacacaactcattaaat
actaactctatttttaaacttattgcagataataaagactttttatgggtaagtactgat
aacggtctttatcaacttaatttagatacgcttaacatcaccacgtacacaataaaagat
ggcttaagtaacaatcactttacagctctagcagcattaaggttacacaacaacgagtta
gcgtttggtaaccgtagcggcgtgctaatgtttgacccagagcaatttgataatgaacag
cgaaaaatcaataataacttagcaattactaatattagtttgttttcacaagcccttaat
tactccccttcaaaatacagcactgatccattaatgcttaagcacgacgatatgggctta
acggttcggttttcaaattttgattataaaaatattaataaaacctactacaaagttgag
cttacaggcccttcgtctttgagctacaacgatttaaaatctaaccaggtgttttttact
aaattacaacctggtgattatattttgtctgtgtctactcaacagcgaaatggagtgatc
acaagtgaccccatacagttaaaatttagtgtagcttacgccccttggcagtctcctatt
gcatatactttatattttattgctattgctgttattttgttttatttttctggcaatacc
gaagccgtaaaattgcaattgaacaagctcaccgcgccgctgtgcactctaaaacacaaa
ctgagctggcactaaaaagtaataaaagcggtgtatggaactatagctttgcagataact
cagtaaatacagatagaggcgcagagcttggctacgagaacttacctgaacgcatcgata
taagtagtttttttaatattatgcatcctgatgagcgtcgcaggctacaaagtaaatgga
atacttttacaaaccaaactaagcaaaaacattggcaagctacttatcgtttacggcaca
aagatgggcactggttatggtttcatgatttggggcaaactatttataatgaagacacta
aagagcctctttatgtgtcgggtatttttactaatattaccgagcagctggcaaacgaac
aacaagccaaaatattaggcgaagcatttagtcaaataaatgactttttacttattttag
atgaagacctcgtgccattttcagccaataacagctttatggatgtgttttctgatgaag
gcagagagggggttgttacctcaaaattatttattaatgccattggacaagctaagtgta
gagagtttgcaacaattttaaaagcacttaaaccaaaagaaaactggcgaacaaatgctt
atgtaaagaccacaaaagctgaaaaacaccctattcatttaagtgccacagccgttgcta
atgaaaaagataaagtcagttattatgttattgttattaccgatttaacagagcagaaac
gcgctgaaaatgagttacgctaccttgctaattacgatgcgttaacgggcttacctaatc
gtagtttaatgaatcaaaaaatcgaaaatgccattacaagcgccgctaaagacgattcgc
aatgcgctgttatatttatagatttagataaatttaaacccgtcaatgactcttttggcc
atgcagtgggtgacaaactattgtgcaatattaccgagcgagtgagccaatacttaggtg
atgacgctacatttggccgccaaagtggtgatgaatttttagtgttagttgaaaacgtta
cctcaatggcctctttacaacacactctcaacgaaatgagcaaagagctggctaacaagg
ttattattgaagacttcgctattaatatatcagccagtattggtattgcattgtacccat
acgatgcaacatcgaccgatgccctcatacgtaacgcagatattgccatgatgcatgcta
aacaagcaggcagaaatggatttcagttttttaatgaaaaaatgaatgagcaaattaaac
aaaagcttattcttgaaaacgacttaaaagatgctgctagggacaatctgttttttaatc
actatcaacctattgttaatacactagataaaacaataagtggggttgaattactcatgc
gctgggaaaacaaaggcaaaccggtttctcccgctttatttatacctattgctgaagaga
ctggcttaattgatatgttaactgagcaagcattacagcgtgcaattactgagcttgctc
cacttttgaacattaacccgttgttttacatatcgttaaatttgtctccaaaacatattt
taaaggccaatataacgcagcagctcagctccatactagaaaaagcacagataaaaccac
aacaacttcgtttagaaattacagaaaacacgctattagaagataaatacaaagcagcta
agcaactaaaaagcttacaggctgctgggttcaaactgtttcttgatgattttggcactg
gctattcatcgttaacttatttgagtcaatttccaattaatgtgataaaaatagatcaaa
gctttgttaatagtattggtattgataaaggggatgaatctattattaaaacgatttact
cactcgctgaaaacttagagttatattgtattgcagaaggggtagagacgcgggagcagc
tagaatttttaaaaaatattggctgtcataagctacaaggttactaccttgctcgcccta
tgagtgctaacgatttaatgagcccagaatgcttcgaaaaaattattgatttgatatga

DBGET integrated database retrieval system