KEGG   Rahnella aquatilis CIP 78.65 = ATCC 33071: Rahaq2_4259Help
Entry
Rahaq2_4259       rRNA      T01770                                 

Definition
(GenBank) 5S ribosomal RNA
  KO
K01985  5S ribosomal RNA
Organism
raq  Rahnella aquatilis CIP 78.65 = ATCC 33071
Pathway
raq03010  Ribosome
Brite
KEGG Orthology (KO) [BR:raq00001]
 09120 Genetic Information Processing
  09122 Translation
   03010 Ribosome
    Rahaq2_4259
 09180 Brite Hierarchies
  09182 Protein families: genetic information processing
   03011 Ribosome [BR:raq03011]
    Rahaq2_4259
  09184 RNA family
   03100 Non-coding RNAs [BR:raq03100]
    Rahaq2_4259
Ribosome [BR:raq03011]
 Ribosomal RNAs
  Prokaryotes
   Rahaq2_4259
Non-coding RNAs [BR:raq03100]
 Ribosomal RNA
  Large subunit rRNA
   Rahaq2_4259
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Position
complement(4530826..4530941)
Genome map
NT seq 116 nt NT seq  +upstreamnt  +downstreamnt
cctggcggcagtagcgcggtggtcccacctgaccccatgccgaactcagaagtgaaacgc
cgtagcgccgatggtagtgtggggtctccccatgcgagagtagggaactgccaggc

DBGET integrated database retrieval system