KEGG   Rahnella aquatilis CIP 78.65 = ATCC 33071: Rahaq2_4336Help
Entry
Rahaq2_4336       gene      T01770                                 

Definition
(GenBank) pseudogene
Organism
raq  Rahnella aquatilis CIP 78.65 = ATCC 33071
SSDB OrthologParalogGene clusterGFIT
Position
4618585..4618851
Genome map
NT seq 267 nt NT seq  +upstreamnt  +downstreamnt
atgaacaacgactcggtcactgagcaatctggtatttttgccggtgacggcggctttgat
atcacggcaggcgggcatacgcagcttgatggcgcggtaattgccagcacaggtccggcg
gataaaaacagcctcgataccggtacgttaggcttcagcgataccggcaataaagcggca
agtgcaacacccaaagcagggcaaacaccctgctttggttttaaaacagatcagcgttct
tcagacaaatacattttacgcaggtaa

DBGET integrated database retrieval system