KEGG   Rahnella aquatilis CIP 78.65 = ATCC 33071: Rahaq2_4359Help
Entry
Rahaq2_4359       ncRNA     T01770                                 

Definition
(GenBank) GlmZ RNA activator of glmS mRNA
  KO
K18505  small regulatory RNA GlmZ
Organism
raq  Rahnella aquatilis CIP 78.65 = ATCC 33071
Brite
Messenger RNA biogenesis [BR:raq03019]
 Prokaryotic Type
  Bacterial mRNA degradation factors
   Other RNA degradation factors
    Bacterial Small RNA Regulators
     Rahaq2_4359
Non-coding RNAs [BR:raq03100]
 Other RNA
  Unclassified
   Rahaq2_4359
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Position
complement(4642568..4642772)
Genome map
NT seq 205 nt NT seq  +upstreamnt  +downstreamnt
gtagatgctcattccacccattatgtttgccccggcttcataaacctgggaatgatgcag
agccaatttacagtgcctattgtcatcctgaccgataacgcgcaagcgctatcatccaga
aggcaaaacgttgagtgaggcactaaatctgttgtcctagacctgattgtttttagacac
ttgtcttccagacaagtgttttttt

DBGET integrated database retrieval system