KEGG   Rhodobacter capsulatus: RCAP_rcc00607Help
Entry
RCAP_rcc00607     CDS       T01213                                 

Gene name
cspA1
Definition
(GenBank) cold shock protein CspA-1
  KO
K03704  cold shock protein (beta-ribbon, CspA family)
Organism
rcp  Rhodobacter capsulatus
Brite
KEGG Orthology (KO) [BR:rcp00001]
 09180 Brite Hierarchies
  09182 Protein families: genetic information processing
   03000 Transcription factors [BR:rcp03000]
    RCAP_rcc00607 (cspA1)
Transcription factors [BR:rcp03000]
 Prokaryotic Type
  Other transcription factors
   Others
    RCAP_rcc00607 (cspA1)
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Motif
Pfam: CSD OB_RNB
Motif
Other DBs
NCBI-ProteinID: ADE84372
UniProt: D5ANL8
Position
652652..652858
Genome map
AA seq 68 aa AA seqDB search
MANGTVKFFNQNKGFGFIEPEGGAQDVFVHISAVERAGISRLVDGAKVTFQIESGRDGRK
SACDLALV
NT seq 207 nt NT seq  +upstreamnt  +downstreamnt
atggccaatggcaccgtgaagtttttcaaccagaacaaaggtttcggtttcatcgagccg
gaaggtggcgcgcaggacgtgttcgtgcacatctcggccgtggaacgggccgggatctcg
cgtctcgtcgatggcgccaaggtgaccttccagatcgaatccggccgcgatggccgcaag
tcggcctgcgacctggctctggtctga

DBGET integrated database retrieval system