KEGG   Rhodobacter capsulatus: RCAP_rct00010Help
Entry
RCAP_rct00010     tRNA      T01213                                 

Definition
(GenBank) tRNA-Arg
  KO
K14219  tRNA Arg
Organism
rcp  Rhodobacter capsulatus
Pathway
rcp00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:rcp00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    RCAP_rct00010
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:rcp03100]
    RCAP_rct00010
Non-coding RNAs [BR:rcp03100]
 Transfer RNA
  tRNA
   RCAP_rct00010
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Position
complement(712145..712222)
Genome map
NT seq 78 nt NT seq  +upstreamnt  +downstreamnt
cggtcccgtagctcagctggatagagcagctgccttctaagcagcgggtcgggggttcga
ctcctcccgggatcgcca

DBGET integrated database retrieval system