KEGG   Roseibacterium elongatum: roselon_03240Help
Entry
roselon_03240     CDS       T03060                                 

Definition
(GenBank) 3-polyprenyl-4-hydroxybenzoate carboxy-lyase UbiX
  KO
K03186  flavin prenyltransferase [EC:2.5.1.129]
Organism
red  Roseibacterium elongatum
Pathway
red00130  Ubiquinone and other terpenoid-quinone biosynthesis
red00627  Aminobenzoate degradation
red01100  Metabolic pathways
red01110  Biosynthesis of secondary metabolites
red01120  Microbial metabolism in diverse environments
red01220  Degradation of aromatic compounds
Brite
KEGG Orthology (KO) [BR:red00001]
 09100 Metabolism
  09108 Metabolism of cofactors and vitamins
   00130 Ubiquinone and other terpenoid-quinone biosynthesis
    roselon_03240
  09111 Xenobiotics biodegradation and metabolism
   00627 Aminobenzoate degradation
    roselon_03240
Enzymes [BR:red01000]
 2. Transferases
  2.5  Transferring alkyl or aryl groups, other than methyl groups
   2.5.1  Transferring alkyl or aryl groups, other than methyl groups (only sub-subclass identified to date)
    2.5.1.129  flavin prenyltransferase
     roselon_03240
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-ProteinID: AHM05503
UniProt: W8RW33
Position
3110031..3110243
Genome map
AA seq 70 aa AA seqDB search
MLLTREAPLTLAHLRNMTAATEMGAILMPPVPPFYLPHATVTDIARQIAARAVDLLAVAP
PVAAAWGGSG
NT seq 213 nt NT seq  +upstreamnt  +downstreamnt
gtgttgctgacccgcgaggcgccgctgaccctggcgcatctgcgcaacatgaccgccgcg
accgagatgggggccatcctgatgccgccggtgccgcccttctacctgccgcatgcgacc
gtcacagacatcgcccgccagatcgccgcgcgggccgtcgatctgctggccgttgcaccg
cccgtggcggccgcctggggcgggtcgggctga

DBGET integrated database retrieval system