KEGG   Rattus norvegicus (rat): 100362040Help
Entry
100362040         CDS       T01003                                 

Gene name
Ac2-143
Definition
(RefSeq) Ac2-143-like
Organism
rno  Rattus norvegicus (rat)
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 100362040
NCBI-ProteinID: NP_001171288
RGD: 2324563
Ensembl: ENSRNOG00000030738
UniProt: Q7TPJ8
Position
9q36
AA seq 589 aa AA seqDB search
MCKALSWMLCTWKRKEKGKEEGGDGVEGEEEEEEKTTPPLTEFKHIQKSVKARACDWAVE
GKGGTLRVGVGREERREGERKEETKEEEGERERSNFLNATPTMMAGNESSKKNVEKSEPF
NTADGNKKVVLRLLKADWAGQFPQVIQEEICGMAPNDSPEKDLGNADACSTLFSNHVPPQ
KHHCLCVDHLADDSKDPRGNLGLGLSGGTELSPQHSIPSPFPPMPTIAEGPFRLHAHLII
KTNHIKDLVAVELHLKSVFMTHCHQLLLKPHPTTVLVRCTWYTQLIKGGLNLLAKRSMRA
CEKAQQSPAQLPHSHMQMFQAMSGKAKTECAPYNAQKLGSTITHFKPRTKMNPSSLKNTG
ALTGRGHQRGKDIIAVASQIQWNGVSQESRDRVGHSGTPFIPSTPKEEACDLQFQNSQGY
MARPCLNQEAMTHTRARTVLAAFRRLTEEDGELEASWGYGKYLNKKQWGIGLVSTCDVPA
LRTLLTAWLHGTLQLSALPDCPFTQATLQSVLSGHPVWTRDSPSLRPPQSGHSQTPLTDM
RRHGRREVPECKPGLTLLTCLGHRSAPFNHVMKTFILHKLKKMTVLENR
NT seq 1770 nt NT seq  +upstreamnt  +downstreamnt
atgtgcaaggccctaagttggatgctttgtacctggaaaagaaaagagaagggaaaagag
gagggtggagatggagtagaaggagaggaggaggaagaggagaagacaacaccaccactg
acagagtttaaacatatacagaagtcagtaaaggctagagcttgtgattgggcagtggaa
gggaaaggtgggactctgagagtgggagtaggtagagaggagagaagggaaggagagaga
aaggaggagacaaaagaggaggagggagagagggagaggagcaatttcctaaatgccaca
cccactatgatggctggaaatgaaagttcaaagaagaatgtggagaaatcagaacccttt
aacactgctgatggcaacaaaaaagtagtcctacggcttttgaaagcagactgggcaggt
caatttccacaggtcattcaggaggaaatctgtgggatggcaccaaatgacagcccagag
aaggacctggggaatgcagacgcctgctccacactattctcaaatcatgtcccacctcaa
aagcaccactgtctctgtgtagaccatttagcagatgactctaaagatcctagaggtaac
cttgggctggggcttagtggtggaacagagttaagtcctcagcactcaattcccagccca
ttccctcctatgccaaccattgctgagggtcctttccgtcttcatgcacatctcattatc
aagacaaaccacataaaggatcttgtagccgttgaattacatttgaaaagtgtcttcatg
actcactgccaccaactcctgcttaagccccatcccacaacggtcttggtgagatgtact
tggtacacccagttgattaaaggtggcttaaatcttttggcaaagcgcagcatgcgggcc
tgtgagaaggctcagcaaagtcctgcacagctgcctcattcacacatgcagatgttccag
gcaatgagtgggaaggccaagacggagtgtgcaccctacaacgcccagaaactaggttcc
accatcacacattttaaaccacgaaccaaaatgaacccatcttcccttaaaaacactggg
gctcttactgggagaggtcaccagagagggaaagacattattgcagtggcctctcagatt
cagtggaatggggtgtcacaggaatcgagagatcgggtggggcacagtggcacacccttt
attcccagcactcccaaggaagaggcatgtgatctacagttccagaacagtcaaggctac
atggccagaccctgtctcaatcaggaagccatgacgcacacccgtgctcgaactgtactc
gcagcattcagacgcctgacagaggaggatggggagttagaggccagctggggctatgga
aaatatctcaacaaaaaacagtgggggatagggctggtctccacgtgtgatgttcctgcc
ctcaggactctgctgacagcctggctccacggaaccctgcagctctcagccctcccagac
tgcccatttactcaagcaacactccagtcagtcctcagcggacatccagtctggacccga
gactctccctcccttcgccctccacagtcaggccattcacagacaccactgactgacatg
agaagacatggtagaagggaagtgccggagtgtaaaccaggcctgactctgctcacctgc
ttggggcacagatctgcccctttcaatcatgtcatgaagacatttatactacacaaactg
aagaaaatgacagtgctggaaaacagatga

DBGET integrated database retrieval system