KEGG   Rattus norvegicus (rat): 100362078Help
Entry
100362078         CDS       T01003                                 

Gene name
Pate-A
Definition
(RefSeq) prostate and testis expressed family member-like
Organism
rno  Rattus norvegicus (rat)
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 100362078
NCBI-ProteinID: NP_001257316
RGD: 2318904
Ensembl: ENSRNOG00000024026
UniProt: D3ZHN8
Position
8q21
AA seq 115 aa AA seqDB search
MGKLLFLLLLLGSFALVFIQVQATVCMVCNSFKSGHCLAGKSNCTTRYKPGCRTRNFFLF
SNTGKWVHNHTELDCHKACLAENMYLGALKISTFCCKGEDFCNKYHGQVVKKKIY
NT seq 348 nt NT seq  +upstreamnt  +downstreamnt
atgggcaagctcctgttccttctcctgctcctggggtcatttgctcttgtgttcatccaa
gtccaagctacagtgtgcatggtttgcaactcttttaaaagtggacattgtttggctggc
aagagcaactgcactacaagatacaagcctggatgcagaaccaggaatttcttcctattc
tccaatacaggcaagtgggtccacaatcataccgaattggactgccataaggcatgtctg
gctgaaaatatgtatttgggagcattgaagatatctaccttttgctgcaaaggtgaagat
ttctgtaataaatatcatggccaagtagtgaagaagaaaatttactaa

DBGET integrated database retrieval system