KEGG   Rattus norvegicus (rat): 113882Help
Entry
113882            CDS       T01003                                 

Gene name
Hemgn, Edag-1, Edag1, Hgn, RP59
Definition
(RefSeq) hemogen
Organism
rno  Rattus norvegicus (rat)
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 113882
NCBI-ProteinID: NP_579828
RGD: 621569
Ensembl: ENSRNOG00000009436
UniProt: Q6AZ54
Position
5q22
AA seq 482 aa AA seqDB search
MDVRKDQSHLTLNQTPEAHVEKSHAPDIIGSWSLRNREQLKKRKAEAQGRQTSQWQLGEQ
KKRKYQRTGKGNRRGRKRQGNVEQKAESWSQTENERVQEVLVPAEEETEYSGNTATQALP
LRASPTKAVPTEHCSEVPQESLQCQEITIQNHSQTHQRRDKAEALSPTTCQEIGVLQYSP
KMCQDMAEPEARSPKMCQETAVPQTYSPKAHEDMAEYEALSPKMCRETPVPQYHSSKIPQ
DMTGPEALAPDMCQETTVSQNHSSKVPQDMAGPEALSLKMCQEPTVLQEHTLKICQDVAR
PDVLSSKTHQEMTVPKALPCITPGDAAGPEGCSPKTLPQSDVTPMSVTPGKNTSHPDLGT
AVAEGCFSEAGECIVSEDISTKTHQEAVEPKFLSHKTYKEFTVPIVSSHKTIQESPGPEE
YSPGSRHEMSEPEDLSIKTCKNRDGPKHSLPEGAQEVGGAQRQDPDAQDIEDAGAFSQDL
EE
NT seq 1449 nt NT seq  +upstreamnt  +downstreamnt
atggatgtgaggaaggaccaatctcatctgacgctcaaccagacccctgaagctcatgta
gagaagtcccatgctccagacatcattggatcttggagtttgagaaacagagaacaactg
aagaagagaaaagctgaggcacaggggaggcagacgtcacaatggcaacttggagaacag
aaaaaacgcaagtatcagagaacaggaaaaggtaatcgaagaggccgaaagagacaaggg
aatgtggaacaaaaggcagagtcttggtcacaaacagaaaacgaaagggtacaggaggta
ttggtacctgctgaggaagaaactgagtactctggaaacactgcaactcaagcccttccc
ttgagagcatcccccacaaaagctgtgcctacagaacactgttctgaagtaccccaagaa
agcttgcagtgccaagaaataactatacagaaccattctcaaacacaccaacgaagggac
aaagctgaagctctctctcctaccacgtgccaagaaataggagtacttcaatattctcct
aagatgtgccaagatatggctgaacctgaggcacgctcacctaaaatgtgccaggagaca
gctgtgccccaaacctattctcccaaagcacacgaagatatggctgaatatgaggcactt
tcgcctaaaatgtgccgggaaacacctgtgccacaataccattcttccaaaataccccaa
gatatgaccggacctgaggcgttagctcctgatatgtgccaagaaacaactgtgtcccaa
aaccattcttccaaagtaccccaggatatggctggacctgaggcgctctctcttaaaatg
tgccaggaaccaactgtgcttcaagaacatactttgaaaatatgccaagatgtggccaga
cctgacgtcctctcttctaaaacacatcaagagatgactgttcccaaagcccttccctgt
ataacacctggagatgctgctggcccagaaggatgctcccccaaaacactcccccagtca
gatgtaacccccatgtcagtcacaccaggaaaaaatacttcccacccagatctgggaacg
gctgtggctgaaggctgcttttctgaagccggagaatgcattgtatctgaagacatttct
acaaaaacacaccaagaagcagttgaacctaaattcctttctcacaagacttacaaagaa
ttcactgtgcctatagtctcctctcataaaaccatccaagaatcacctgggcctgaagaa
tattcacctggaagccgtcatgaaatgtcagagcctgaagacctctctatcaagacctgt
aagaacagggatgggcctaaacacagccttccagaaggagcccaggaagtaggtggggcc
cagaggcaggaccctgatgcacaggatatcgaggacgctggtgctttctctcaagacctg
gaggaatga

DBGET integrated database retrieval system