KEGG   Rattus norvegicus (rat): 116699
Entry
116699            CDS       T01003                                 

Gene name
Inpp4b
Definition
(RefSeq) inositol polyphosphate-4-phosphatase type II B
  KO
K01109  inositol polyphosphate-4-phosphatase [EC:3.1.3.66]
Organism
rno  Rattus norvegicus (rat)
Pathway
rno00562  Inositol phosphate metabolism
rno01100  Metabolic pathways
rno04070  Phosphatidylinositol signaling system
Module
rno_M00131  Inositol phosphate metabolism, Ins(1,3,4,5)P4 => Ins(1,3,4)P3 => myo-inositol
Brite
KEGG Orthology (KO) [BR:rno00001]
 09100 Metabolism
  09101 Carbohydrate metabolism
   00562 Inositol phosphate metabolism
    116699 (Inpp4b)
 09130 Environmental Information Processing
  09132 Signal transduction
   04070 Phosphatidylinositol signaling system
    116699 (Inpp4b)
Enzymes [BR:rno01000]
 3. Hydrolases
  3.1  Acting on ester bonds
   3.1.3  Phosphoric-monoester hydrolases
    3.1.3.66  phosphatidylinositol-3,4-bisphosphate 4-phosphatase
     116699 (Inpp4b)
SSDB
Other DBs
NCBI-GeneID: 116699
NCBI-ProteinID: NP_446369
RGD: 620470
Ensembl: ENSRNOG00000018382
UniProt: Q9QWG5
Position
19q11
AA seq 942 aa
MEIKEEGTSEEGQHFLPAAQANDPEDIQFTSIQKSPNEPQLEFILACKDLVAPVSDRKLN
TVVQVSVIHPVEQTLTRYSSTEIVEGTKDPLFLTGVTFPSDYPIYEETRIKLTVYDVKDK
PHDTIRTSVLPEHKDPPPEVARSFLGCASFKVGELLKSKEQLLSLSLRTSDGGKVVGTIE
VSLVKMGEIEDGDTDHITTDVQGQKCALVYDSTAPESLSGKENLPFMNAVLRNPVCKLYR
FPTSDNKWMRIREQMSESILSFHIPKELISLHIKEDLCRNQELKELGDLSPHWDNLRNNV
LSHCDQMVTMYQDILTELSKETGSSFKSSSSKGEKTLEFVPINLHLQRMQVHSPHLKDAL
YDVITVGAPAAHFQGFKNGGLRKLLHRFETERRNTGYQFIYYSPENTAKAKEVLSSINQL
QPLVATHADLLLTSASQHSPDSLRSSLKLLSEKTELFVHAFKDQLVRSALLALYTARPGG
ILRKPPSPKVSTEEKSSQHDSPQQLRRQDSIPHHSDYDEEEWDRVWANVGKSLNCIIAKV
DKLIERDSRNDKSTGGDSSKDGDADPNLEDSLTSHPREDWYEQLHPLILTLKECMAEVVN
RAKQSLTFVLLQELAYSLPQCLMLTLRRDIVFSQALAGLVCGFIIKLHTSLHDPGFLQQL
HTVGLIVQYEGLLSTYSDEIGMLEDMAVGISDLRKVAFKITEATSNDVLPVLTGRREHYV
VEVKLPATVFESLPLQIKEGQLLHVYPVLFNVGINEQQTLAERFGDVSLQESINQENFEL
VQEYYSIFMEKMPPDYISHFQEQNDLKGLLDNLHQNIQAKKRKNVEIMWLAATICRKLNG
IRFTCCKSAKDRTSMSVTLEQCSILRDEHQLHKDFFIRALDCMRSRQTQGALNESDDPET
GCLSDNKPTSRHFYPVALLLVSSHLLVVWLILSLALLLAKYQ
NT seq 2829 nt   +upstreamnt  +downstreamnt
atggaaatcaaagaggaaggaacgtcagaagaaggccagcattttcttccagcagctcag
gcaaatgaccctgaggacattcagtttaccagcatccagaagagtcccaatgagccacag
ttggaattcattcttgcctgcaaggaccttgtggctcctgtcagtgatcggaaactgaat
acagtagtacaggtctcagtaatccaccccgtggagcagaccctgacgaggtactccagc
acagaaattgtggagggaacaaaagacccactgttcctgacaggcgtcacattcccatcc
gactaccccatctatgaagagacaagaataaaactgacagtctatgatgtcaaggataag
ccgcatgatactattcgaaccagtgtccttccggaacacaaggatcccccgccagaagtt
gcgagaagcttcctgggctgtgccagctttaaagtcggggagctgctgaagtccaaggag
caactgctgtccctgagcctgaggacctcagatggtggcaaagtggtcggcaccatagaa
gtcagcctcgtgaagatgggggagattgaggatggggacaccgaccacatcacaacagac
gtgcagggacaaaagtgtgccctagtgtatgattctaccgcaccagagagtctgagtggg
aaggaaaacttacctttcatgaacgcagtgttaaggaatcctgtgtgtaaactgtacaga
ttccccacgtctgacaataagtggatgcgaatccgtgagcagatgtcagaaagcatcctt
tcttttcatattcctaaggaattgatttcccttcacatcaaagaagacctatgcagaaac
caggagttaaaagaacttggtgacctttctccacactgggacaacctacggaacaatgtc
ctttctcactgtgatcaaatggtgactatgtaccaagatattctgacagaactttccaag
gaaacggggtcctccttcaaatccagcagcagcaaaggagagaaaacattagaatttgtt
ccaataaacctgcacttgcaacggatgcaggtgcacagccctcacctgaaagatgctctc
tatgatgtcatcactgtgggggccccagctgcccattttcagggattcaagaatggtggt
cttcgaaaactactccatagatttgagacagagagaaggaacaccgggtaccagtttatt
tattattcgcccgagaacacggccaaggcaaaggaagttctcagcagcatcaatcagctg
caacctctcgtagcgactcatgcggacctgctgctaacctctgccagccagcattctcct
gacagcctgaggagttctttaaagctgctttcagaaaaaaccgagctttttgtgcatgcc
ttcaaggaccagctggtcaggagtgctctcttagctctctacactgcgaggccaggaggt
atccttaggaagccaccttctcctaaggtcagcacagaggagaaaagtagccagcatgat
agcccgcagcagcttagaagacaagactccataccacatcactctgactatgatgaggaa
gagtgggacagggtgtgggccaacgtgggaaagagcctaaactgtattatcgctaaagtt
gacaaactgatcgagagagacagtcgcaacgacaaaagtactggaggcgacagtagcaag
gacggagatgcggaccctaacctggaagattccctcacatcccacccaagggaggactgg
tatgaacagctgcacccactcatccttaccttgaaggagtgcatggcagaagtggtgaac
cgagcgaagcaatccctgacatttgtgctgcttcaggaactcgcctacagtctgccccag
tgtttgatgctgactctgaggagagacatcgtcttcagtcaggcgcttgctggattggtt
tgtggttttatcatcaaactacacacaagtttgcacgaccctggcttcctccagcagctt
cacacagtgggcttgatagtgcagtacgaagggctgctaagcacttacagtgacgaaatc
ggaatgctggaggacatggctgtcggcatttcagacttaaggaaggtcgctttcaaaata
acggaagccacatccaatgatgtcctccctgttctcacaggaaggcgcgaacactacgtg
gtggaggtcaagcttccagcgacagtgtttgagtcgctccctctgcaaattaaagaaggc
cagttgcttcatgtgtatcctgttctgtttaacgttggaatcaatgagcagcagactctg
gccgagaggttcggagatgtttctttgcaagaaagtattaatcaagaaaattttgagctt
gtacaagaatattattcaatatttatggaaaagatgccgcctgattatatttcacatttt
caagaacaaaatgatttaaaaggactgttggacaatctccaccaaaatatccaagccaag
aaaagaaaaaatgtagaaatcatgtggctggcagcaacgatttgtcgcaaactcaatggc
attcgttttacctgctgcaaaagtgccaaagacaggacatcaatgtcagtgacgctggaa
cagtgctccatcctgagagacgagcatcagctccacaaagactttttcatcagagcatta
gattgcatgaggagcagacaaacccagggggccttgaatgagtcggatgatcctgagaca
ggctgcctaagcgataacaagccgacttctcgacacttctaccctgtcgccctgcttctt
gtcagttcacatctgctagttgtgtggctcattttaagtcttgctttactcttagccaaa
taccaataa

DBGET integrated database retrieval system