KEGG   Rattus norvegicus (rat): 24631Help
Entry
24631             CDS       T01003                                 

Gene name
Rhox5, Pem
Definition
(RefSeq) reproductive homeobox 5
Organism
rno  Rattus norvegicus (rat)
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 24631
NCBI-ProteinID: NP_071511
RGD: 3295
Ensembl: ENSRNOG00000046548
Vega: OTTRNOG00000002029
UniProt: Q63630
Position
Xq35
AA seq 211 aa AA seqDB search
MEAQGSSHDISRLLCLGVKEDSEEQHGQYLGDVKAEAFFQAGEGRDEKGAQGQPGEGAVG
TEGEGEELNGGEGHFGPGVPGPVGEGDKDGGTRASGMEEEQHEPVAEGTESVKSEDKQMP
LRRPGSTQRRLAELERILLSSGSSSGGRSLIDGWISVCPECRNWFKIRRAAYRRNRRRRT
PIPEHFRATSGCPACLGARWGVRCPFATPRF
NT seq 636 nt NT seq  +upstreamnt  +downstreamnt
atggaggctcaaggctctagccatgatatcagccgcttactctgcctgggagtcaaggaa
gactcggaagaacagcatggtcagtacctgggtgatgtgaaagcagaggctttctttcag
gctggagaggggagagacgagaaaggtgcacagggtcagcctggagagggagcagtggga
acagaaggcgaaggagaagaattaaatggaggagaaggccactttggtcctggtgttcca
ggtcctgtgggtgagggggacaaggatggtggcaccagagctagtggcatggaggaggag
caacatgagcccgttgccgagggcactgagagtgtcaagtctgaggataagcagatgcca
ctccgccgccctgggtccacccagcggcggctggcggaattggagcgcattttgctaagc
agtggttcctccagtggcgggaggagcttgatagatggatggatatcagtgtgtccagag
tgcaggaattggtttaagattaggagggctgcatacagaagaaataggaggcggagaaca
ccaatccctgaacattttagagcaacatctgggtgccctgcttgtcttggagcaagatgg
ggagtaagatgtccttttgcaacaccgagattttga

DBGET integrated database retrieval system