KEGG   Rattus norvegicus (rat): 25295
Entry
25295             CDS       T01003                                 

Gene name
Bglap
Definition
(RefSeq) osteocalcin preproprotein
  KO
K22609  osteocalcin
Organism
rno  Rattus norvegicus (rat)
Pathway
rno04928  Parathyroid hormone synthesis, secretion and action
Brite
KEGG Orthology (KO) [BR:rno00001]
 09150 Organismal Systems
  09152 Endocrine system
   04928 Parathyroid hormone synthesis, secretion and action
    25295 (Bglap)
SSDB
Other DBs
NCBI-GeneID: 25295
NCBI-ProteinID: NP_038200
RGD: 2206
Ensembl: ENSRNOG00000019607
Vega: OTTRNOG00000002061
UniProt: P04640
Position
2
AA seq 99 aa
MRTLSLLTLLALTAFCLSDLAGAKPSDSESDKAFMSKQEGSKVVNRLRRYLNNGLGAPAP
YPDPLEPHREVCELNPNCDELADHIGFQDAYKRIYGTTV
NT seq 300 nt   +upstreamnt  +downstreamnt
atgaggaccctctctctgctcactctgctggccctgactgcattctgcctctctgacctg
gcaggtgcaaagcccagcgactctgagtctgacaaagccttcatgtccaagcaggagggc
agtaaggtggtgaatagactccggcgctacctcaacaatggacttggagccccagccccc
tacccagatcccctggagcctcacagggaggtgtgtgagctcaaccccaattgtgacgag
ctagcggaccacattggcttccaggacgcctacaagcgcatctatggcaccaccgtttag

DBGET integrated database retrieval system