KEGG   Rattus norvegicus (rat): 25345Help
Entry
25345             CDS       T01003                                 

Gene name
Prm2, PROTA2
Definition
(RefSeq) protamine 2
Organism
rno  Rattus norvegicus (rat)
SSDB OrthologParalogGFIT
Motif
Pfam: Protamine_P2
Motif
Other DBs
NCBI-GeneID: 25345
NCBI-ProteinID: NP_037005
RGD: 3409
Ensembl: ENSRNOG00000002539
UniProt: P11248
Position
10q11
AA seq 104 aa AA seqDB search
MVRYRMRSPSEGQHQGPGQDHEREEQGQGQELSPERVEDYGRTERGHHHRHRRCKRLHRI
HKRRRSCRRRRRHSCRHRRRHRRGCRRSRRRRSCRCRKCRWHYY
NT seq 315 nt NT seq  +upstreamnt  +downstreamnt
atggttcgctaccgaatgaggagccccagtgagggtcagcaccaggggcctgggcaagac
catgagcgcgaggagcaggggcaggggcaagagctgagcccagagcgcgtggaggactat
gggaggacagaaaggggccaccaccacagacacaggcgctgcaagaggcttcacaggatc
cacaagaggcgccggtcatgcagaaggcggaggagacactcctgccgccacaggaggcgg
catcgcagaggctgcagaagatcccgaaggaggaggagctgcaggtgcaggaaatgcagg
tggcactattattaa

DBGET integrated database retrieval system