KEGG   Rattus norvegicus (rat): 29151Help
Entry
29151             CDS       T01003                                 

Gene name
Ucn
Definition
(RefSeq) urocortin
  KO
K23142  urcortin
Organism
rno  Rattus norvegicus (rat)
Pathway
rno04080  Neuroactive ligand-receptor interaction
Brite
KEGG Orthology (KO) [BR:rno00001]
 09130 Environmental Information Processing
  09133 Signaling molecules and interaction
   04080 Neuroactive ligand-receptor interaction
    29151 (Ucn)
BRITE hierarchy
SSDB OrthologParalogGFIT
Motif
Pfam: CRF
Motif
Other DBs
NCBI-GeneID: 29151
NCBI-ProteinID: NP_062023
RGD: 3929
Ensembl: ENSRNOG00000006090
UniProt: P55090
Position
6q14
AA seq 122 aa AA seqDB search
MRQRGRATLLVALLLLVQLRPESSQWSPAAAAANVVQDPNLRWNPGVRNQGGGVRALLLL
LAERFPRRAGSEPAGERQRRDDPPLSIDLTFHLLRTLLELARTQSQRERAEQNRIIFDSV
GK
NT seq 369 nt NT seq  +upstreamnt  +downstreamnt
atgaggcagaggggacgcgctacgctcctggtagcgttgctgcttctggttcagctgcgc
ccggagagcagccagtggagcccagcggctgcggcggcgaatgtggtccaggatccgaat
ctgcgatggaaccccggagtgcggaatcagggcggaggtgtccgcgcactcctcttgctg
ttagcggagcgcttcccgcgccgcgcgggatctgagcctgcaggcgagcggcaacgacga
gacgacccgccgttgtccatcgacctcaccttccacctgctgcggaccctgctagagcta
gctcggacacagagccagcgcgagcgcgcagagcagaaccgcatcatattcgattcggtg
ggcaagtga

DBGET integrated database retrieval system