KEGG   Rattus norvegicus (rat): 292846Help
Entry
292846            misc_RNA  T01003                                 

Gene name
Siglec8, RGD1563073
Definition
(RefSeq) sialic acid binding Ig-like lectin 8
Organism
rno  Rattus norvegicus (rat)
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 292846
RGD: 1563073
Position
1q22
NT seq 3276 nt NT seq  +upstreamnt  +downstreamnt
cactcaaaggctaaggttaatacagagaaagtgaagagggggtcaggccctgaactggtg
agtgtgggagagtccgtctttggtctcaggagcagatctgggtggtaggtggttggtatt
caaggaccaaaggtcctcacagtgcctgggtctgaagctcctcctcctggggcagccact
atcctggccctcaccgctgcttccgctggggcttcctccaagccttgcatctcttagttc
ctcaaagcagagcctggagagacattttcagctggacatgctgctgttgctgctgctact
ctgggggataaagggagtggagggtggagccgttgccttgaagggctacaccctgaatgt
ggaaaggaaggtggtggtacaggagggcctgtgtgtccttgtgccctgcaacttctccta
tcccaagttctggcagactgactcatccccagtttatggatactggttccggaaaaaagc
caacacagacattgatgcccccgtggccacaaataacccaaaaaggccagcacaggaaag
gacccagcatcgattcttcctgcctggagaccagcaaaagaacgactgctccctgaacat
cagagagatcaaaaagaaggatgcagggacatacttctttcgcctggagagaggaaaaac
aaagtataattatctttggaacatgatgactctggatgtgacagctctcactaacaccct
ccgtattctcccggagacacttgaagctggtcatcccagcaacctgacctgctctgtgcc
ttgggactgtgagaagagggcaccccctgtcttctcctggaatggtacctctgtgtcacc
cttgagcactaacaccactggttcctcagtgctaacaatcatcccccagccccaggacca
tggcaccaacctcacttgtcaggtgacccttcctggaactgatgtgaccacaagaatgac
cattcgtctcaacgtgtcatatgctccaaagaatctgactgtgaccgtctatcaaggagc
tgactcagtatccacaatcctgaagaacggctcatctcttcaaatctctgagggccagtc
actccgtctcatctgtagcgccgacagctatcccccggcaaacctaagctggtcctgggg
taacctgactctgtgtccaccaaagttgtctaaacccggactcctggagctgtttccaat
gcatcttaagcacgaaggagtgtatacctgccaagctcagcacgccctaggctcccaata
catttccctgaacctgtctccacagagaagtgcaactttatctgaaatgatgatggggac
ccttatggattcaggtgtcacagccctccttttcctgtctttctgcatcattctcctggc
agtaagatcctgcaggaggaaaccagccaggacagctgtggtagctccgcatccaaatgc
cctcaaggtctcagtgtctcagagtcccctggttgaatcccatgcagatgacagctctga
gcccctgccttccacagttgaggcagccccctcctccacaaaggaagagatacattatgc
ctccctcagctttcatgaaatgaagcccaggaactcctgggggcagcagggctctaccac
agagtactcagagataaggctccacaaatgaccacatggccatgaacattgccagaagga
gcatggcggccacaggaggctggctctgcagaagcaaaagggtcgcctaggttgacatgc
gatgtgtaggacttcagggccgttcttttcatgacacaggcgttctgctactgcccacgc
ccttgtgctaccctgcccacccaattgctattgtgccctggaaatcataagcttgacttt
tttctttctcttcctttccaccaccctctcttgttatttcaagtcagggtttcctgggtt
gaacttgctctgcagaccaagctgctcttgaactcacagagatccccctacctcttcttt
ccaagtgctgggattaaagatgtgcaccagcaccacccagcatttgactttgtaattgta
tgtgtgtggatgtttggcctgcatgcgcatccgtgcaccacatgcatgcctcgtgcctgc
agaggctgggggaggtcatcagctactctggaattggagttacagagggttgtgagtggc
cacgtgggtgctaggaaccgaacccagtcatctgcaagagtatccagtgctcttaaccac
taagccatctctccggtactaagattttttttttttttttttagattttacttaaaaatt
ggcatgtattgtttacacagtgatggtttgctgtgttttctttcaagtgtatcacctatt
ttggccatgctcatccccttctcctgtagttgccagtctcctctctctctccccccaaac
aatccctttactgtgtaacgttgtatgtatcggttacctttcttggttttgtggatagga
cgcggacagaaacatgaaggatggaaaggtttattcttgttcatggtttcagtccatcat
ggtgaggaagggaatatggtggtgctcaagggggcacatgtagtggaggctccacatcgt
gatggatcaggaagcagtgggctcaagccagaaccagatgtagatatcatcttctaagca
cgccccagacacgtacttctataaattgggtcacatgtccgaaagattccacggctttag
aaaatactgtgaccagctgagtaccaagtgtccaaatatatgggcctctgtagaaaatat
acatttaaacccaaactagatggatgatagttggatagacagacagacagggaaaggtta
gtagatattatagatagataatagaaaatagagacatagaaatgagatagacagacttac
agtatagataaaatatacaaggtaagtggtggatataagacagatggacagatagatgac
agagaaaagatgataggcagacaacttgtcagagacgctgctccactctgccttgctttt
tgggaagcatgactgagcgcagctcagagaaaggtgcagacaggggcgctgtggatgctg
gggagctgccaaatgtgtcttaacttggtttcctttccctggtttttaaaaacagtgtat
gtactttgtgagggaaaagtaccttagaaccaaagcaaaaagaagaacgaaacataaaga
ggaaacactggtaatagttaacattttttcaatttttcacttgcatgtgaaaactggact
gaacctgcatttgtgctatacatatcatatctatca

DBGET integrated database retrieval system