KEGG   Rattus norvegicus (rat): 298534
Entry
298534            CDS       T01003                                 

Gene name
Clspn
Definition
(RefSeq) claspin
Organism
rno  Rattus norvegicus (rat)
SSDB
Other DBs
NCBI-GeneID: 298534
NCBI-ProteinID: NP_001100157
RGD: 1309083
Ensembl: ENSRNOG00000011332
UniProt: D3ZHC3
Position
5
AA seq 1223 aa
MTGEVDSEVNLEVGDLKILSQEEVDSGQGSFEALELFSERDSDEEIFVSKKPKSRKVLQD
SDSEAEDNAPEKPTYDSAEENNENLHSGKSQTIKSISTALADSDESSMEGTPCQESLETQ
ETPSLELSHQTASSADFTTDRKLSKALRREGTEGKAKSKRRLEKEERTREKIRRLKKKET
RCEESDADRPLNDSGCLLEDSDLFETGLEEEDDSPLEDEESLESIRAAVKNKKKEPSLES
ETFSLEDESELSKGSGRKERKAAKLSKEALKKLHSETQRLVRESALNLPYHMPESKTIHD
FFKRKPRPSCQGSAMALLKSCKYQSGHHKEAINPADAAGMSADDPSKGSEQRTRAESAKE
TTILPEVSEEAGITAGSDEACGKDPVRGAELEIEETEKYSDGRPSPGDRSVSQQESSISR
SKDSENCHTGELTQSDPPALEGEELKTTEEAEAGEGAAEQKTESAVAPPGKARRFTVDRL
RQLGVDVSSQPRLGADEDSFVILDEPETNRELEALKQRFWRHANPAASPRAHQTLNVNII
VKDLGTDGKEELKAEVVPVTLAAEKLEGASHTKPGEKLQMLKAKLQEAMKLRRLEERQKR
QALFKLDNEDGFEEEEEEEEMTDESEEDGEEEEEEEEEEEEEEEVGDMQETSEYLLGSED
TETKAEKETDKENTDASSDVGKPVALSVPKPLSSDSTLLLFKDTSSKMGYFPTEEKSETD
EHMGKQSDKLDEDDSSSLLTKESSHNSSFELIGSTIPSYQPCNRHTGRGTSFLPTAGFRS
PSPGLFRGSLISSASKSSGKLSEPSLPIEDSQDLYTASPEPKTLFLGAGDFQFCLEDDTQ
SQLLDADGFLNVRNHRNRYQALKPQLPLASMDENAMDANMDELLDLCTGQFTSQSEEKCQ
PRKNDQKENMEELLNLCSGKFPSQDASPVAPLELRTEERESGTEDPMEEALALCSGSFPT
DREEEGEEEEFGDFQLVSKENEFASDEGGHSDSSDEELALDLEDDEEELLKQSEKMKRQM
RLKKYLEDEAEVSGSDVGSEDEYDGEDIDEYEEDAIDEVLPSDEELESQIKKIHMKTMLD
DDKRRLRLYQERYLADGDLHSDGPGRTRKFRWKHIDDTSQMDLFHRDSDDDQVEEQLDET
EAKWRKERIEREQWLREQAQQGKIAAEEEDVGEDSQFMMLAKKVTAKALQKNASRAVAVQ
ESKSVLSNPFETIRAGGNSSSLS
NT seq 3672 nt   +upstreamnt  +downstreamnt
atgaccggcgaggtggattctgaggttaacctggaagtcggtgatctaaaaatcctttca
caagaagaagtagacagtggacagggcagctttgaagcactcgagctctttagtgaaaga
gattctgacgaagagatatttgtgagtaagaagccgaagagcaggaaagtgttacaagac
agcgattctgaggctgaggacaatgctccagagaaacccacctacgacagtgcggaggag
aataatgagaacttacactcggggaagagtcagacgatcaaaagcatctccaccgctctg
gctgacagtgacgagagcagcatggagggaactccgtgtcaggagagtcttgagactcaa
gagactccttccttggagctgagccaccagacagcaagctctgcggacttcaccaccgac
agaaagctctccaaagcactccgcagagaaggaactgaaggaaaagcaaaatccaagaga
agactggagaaagaggagagaacaagggagaaaattaggagactgaaaaagaaggaaaca
agatgtgaggaaagtgatgcagaccggccacttaacgacagtggctgtcttcttgaagat
agtgatctttttgagacaggtttggaggaagaagatgactctccactggaagatgaggag
tcattagagtcaatcagggcggctgtcaaaaacaagaaaaaggaaccatccctggagagt
gagaccttttcattagaagatgaaagtgagttatccaaaggcagtgggaggaaggaaaga
aaggcagcaaagttaagtaaagaagcactaaaaaaactgcatagtgagactcagcgtcta
gtccgagaatctgcacttaatcttccatatcatatgcctgagagtaaaactattcacgat
ttcttcaaacggaagccccggcccagttgccagggcagcgccatggccctgctgaagtca
tgtaagtatcagtcgggccaccacaaggaagccataaacccggcagatgcagctggaatg
agtgccgatgaccccagtaaaggttctgagcagagaacaagggcagaaagtgcaaaggaa
actaccattctccctgaggtctcagaagaagccgggatcactgctggatcagatgaggct
tgtgggaaggatccggtaagaggagcagagctggaaattgaggagactgagaagtacagt
gatggcagaccttctcctggggacagatccgtgtcacagcaagaatcctccatctccagg
agcaaagacagtgagaactgtcacactggagaactcacccagtccgaccctcctgccttg
gagggagaagaactgaaaacaacagaagaagcagaggcaggagagggagcagccgagcag
aaaactgagtcagccgtggcgccacctggaaaggcgagacgattcactgtggaccgactt
agacagctaggcgtggatgtttccagtcagcctcggctgggtgctgatgaagattccttc
gtgatacttgatgaacctgaaaccaacagagaactggaagccttgaagcagcgcttctgg
aggcatgctaacccagcagccagtcccagggcgcatcagacgctgaatgtgaacatcatc
gtgaaggacttgggcactgacgggaaggaggagctgaaggcagaagtggtgcccgtcact
ttggcagcagagaagctggaaggagcgagccacacaaaaccaggtgaaaaactgcagatg
ttaaaagctaagttgcaggaggcaatgaaactccgaaggctcgaggagcggcagaagcgc
caagcgttgtttaaattagataatgaagatggatttgaagaggaggaggaagaggaagaa
atgacagatgagtctgaggaagatggagaagaggaagaagaggaggaggaggaggaggag
gaggaggaggaggttggagacatgcaggagacttcagaatatcttcttggcagtgaagat
acagaaaccaaagctgaaaaagaaacagataaagaaaacacagacgccagtagtgacgtc
ggcaaacctgttgccctctctgtccccaagcccctgtcctcggactccaccttacttctg
tttaaggacacctcttccaagatgggttactttcctactgaagaaaaatcagaaacagat
gaacacatgggcaagcagtctgacaaactggatgaagacgactcaagttcactgctaaca
aaagagagcagccacaacagcagctttgagctcattggctccacaattccatcctatcag
ccctgcaacagacacacaggccgtgggacgagttttctccctacagcaggattcaggtcg
ccatcccctggactgttccggggcagtctgatcagctcggcttctaagagttcagggaaa
ctgtctgagccttcacttcccatagaggattcccaggatctgtacaccgcctccccagag
ccgaagacacttttcctaggagcaggagacttccagttctgtttggaagatgacactcag
agccaactgttggatgcagatggatttttaaacgttagaaatcaccggaatcggtatcag
gctttgaagccacagttgccgctggccagtatggacgagaatgccatggatgccaacatg
gatgagttgctcgacttgtgtaccggacagttcacatctcagtctgaggagaaatgtcag
ccaaggaagaatgaccagaaagaaaacatggaggaacttctgaacctctgctctggcaaa
tttccttctcaagacgcttccccggtggccccactggagctgaggacggaggagagggag
agtggcacagaagatcccatggaggaggcgcttgctctttgctcgggctccttcccaaca
gacagggaggaagagggtgaagaggaggaatttggagactttcagcttgtttcaaaggag
aatgaatttgctagcgatgagggtggacacagtgactccagtgatgaagagctggccctg
gacctggaggatgatgaagaagagctcctgaagcagtctgagaagatgaaacggcaaatg
agactgaagaaatacttggaggatgaggcagaggtgtcaggcagtgacgtgggaagtgaa
gacgagtatgacggggaagatatcgatgagtacgaagaagacgccattgatgaggtgctc
ccatccgacgaggagctggaaagtcagatcaagaaaatacacatgaaaaccatgttggat
gacgataagcggcgactgcggctttatcaagagaggtaccttgctgacggggatctgcac
agtgacgggcctggacgaacaagaaaattccgatggaaacacatagatgacacctcccag
atggatctgtttcacagagactctgatgacgatcaggttgaagaacagcttgacgagact
gaagccaagtggagaaaggagcgaattgaacgagagcagtggcttcgggaacaggctcag
caggggaaaattgctgctgaagaagaggacgttggagaagacagtcagtttatgatgcta
gccaagaaagtcacagccaaggcactgcaaaagaatgccagtcgtgccgtggctgttcag
gaatcgaagtctgtgctcagtaacccttttgaaaccatcagagcgggaggtaactcttct
tccctcagctga

DBGET integrated database retrieval system