KEGG   Rattus norvegicus (rat): 315665Help
Entry
315665            CDS       T01003                                 

Gene name
RGD1311251
Definition
(RefSeq) similar to RIKEN cDNA 4930550C14
Organism
rno  Rattus norvegicus (rat)
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 315665
NCBI-ProteinID: NP_001019436
RGD: 1311251
Ensembl: ENSRNOG00000007266
UniProt: Q569B9
Position
8q24
AA seq 305 aa AA seqDB search
MSMKRPQDHSKQEMAARIIQKAWKTFLNVSVFQHFKSLIDLRRQGEPRQIVKYINPKEAE
LLDAAAGVQVRFRLGGVKFPPEIYYKIFTHRHIEDLCANSPRDYTKLPARYASHNKDDPP
QVEDNSGWYRRIENNGWRPVSNRFWMPTENEVLESTKESEFHFSKLKRKQDLEKKRKIKK
IEWMRQMYYLGSLEAKVTDRETLVLIHKATKGLIKSIEDGGVDSVMEWEVDEVLNWTNTL
NFDDYIASWRETATSNSSAYLKDAKLQRIQKSLQRKIYEDETKESEEKIYYDGDFYENVY
IKPLL
NT seq 918 nt NT seq  +upstreamnt  +downstreamnt
atgtctatgaaacgtccccaagatcattcaaagcaggaaatggctgcaaggatcattcag
aaggcctggaaaactttccttaatgtttccgtgttccagcattttaaaagtctgattgac
ttacgaagacaaggggagcctcgccagatagtgaagtacattaaccctaaagaggcagag
ctcctagatgctgctgctggcgtccaagtccgattcagactgggcggggttaaatttcca
cctgagatatactataaaatttttactcacagacatatcgaagatctgtgtgctaacagc
cctcgagattacacaaagcttccggcaagatacgcatctcataacaaagacgatccacct
caggtggaggacaacagtggctggtatcgccgcatagagaacaatggctggaggcctgtc
tccaatagattttggatgccaactgaaaacgaagtgttggagagcacaaaggaaagcgaa
tttcatttctccaaactgaagagaaagcaagatctggaaaagaaaagaaaaattaaaaaa
attgagtggatgaggcaaatgtactacctgggcagcctggaggccaaggtaacagaccgt
gagacactagttctaatccacaaagcaacaaaaggcctaatcaagagtatcgaagatggc
ggagtggactctgtgatggaatgggaagtcgatgaggtgctgaactggacaaacacgctc
aacttcgatgattatatcgcaagttggagagaaactgctacaagcaactcttcagcttac
ctaaaagatgccaagcttcaacgaatacagaagagcctacagagaaagatctatgaggat
gaaacaaaggagtcagaggagaaaatatattatgatggtgatttctatgaaaatgtttat
ataaaaccactactttaa

DBGET integrated database retrieval system