KEGG   Rattus norvegicus (rat): 360591
Entry
360591            CDS       T01003                                 

Gene name
Prr11, RGD1561541
Definition
(RefSeq) proline rich 11
Organism
rno  Rattus norvegicus (rat)
SSDB
Other DBs
NCBI-GeneID: 360591
NCBI-ProteinID: NP_001101757
RGD: 1561541
Ensembl: ENSRNOG00000006198
UniProt: D4ADC1
Position
10q26
AA seq 368 aa
MPKFKQRRRKLRAKAKRLCKTKEASRVLPKLLAPPPPPPTPERVVTSSADIPQSRNWLRP
SWNLRLPNFKAAINLWTNRAWCIYSCCQTRVAQSLEVLKDAIFPSRVYHRELHSLKQQLC
VLKSELCELQENLKSISEHSSRSSCCHTCCGGDRLTTVPACAPTTHGESQTALPPTLPQP
ASHPPPPPPLLPLPPPPPPLPPPPPPLAPLLLRKSGSTKALQVEPLKKDGPMHITVKDLL
TVKLKKTQNIDERRKFVPSPPEERTPLVTVSDLQRITLKPNSRVLATRIKNVLITPGKSQ
IDLRKLLRKVEVERSPGGTPLNNKENMDTGTGLTPVMTRALRRKFQLAHPQSPTQSLPLS
TSNFDEQN
NT seq 1107 nt   +upstreamnt  +downstreamnt
atgcccaagttcaaacagcgaagaagaaagctaagagccaaagccaaacgattatgtaaa
acgaaagaagcctctcgggtcctgcctaagttattggcacctccccctccaccacccaca
ccagaaagagtggttacttcttcagcagatattccccaaagcagaaactggctaagacca
tcttggaacttaagactccctaacttcaaagctgcaataaacctttggacaaatagagca
tggtgcatatacagttgctgtcagacccgtgtagcccagagtttagaagtattaaaagat
gccatcttcccatcccgagtctaccacagagaacttcacagccttaaacaacaattatgt
gttttgaaaagcgaattgtgcgagctccaagaaaacttgaagagcatctcggaacactcg
tctcgttcgagctgttgccacacgtgctgcgggggtgacagacttacaactgtgcctgcc
tgtgctccaacgacccatggggaatcccaaaccgcacttcctcccacactgccacagcca
gccagccatcctccccctcctccccctcttcttcctcttcctcctccccctccccctctc
cctccacctccaccacccctagcacctttgctgctcagaaaatctggtagcactaaagca
cttcaggttgaaccgttaaagaaagatggacccatgcatataacagttaaagatctactc
actgtgaaattaaaaaagacacagaatattgacgaaaggagaaagtttgtaccatcaccg
ccagaggaacggactccattagttactgtctctgacctgcagcgcattaccctgaaacca
aactccagggtgttggcaactcgaattaaaaatgtcttgattactcctggtaaaagccaa
atcgatctccggaaactgctgagaaaagtcgaggtagaaaggagcccaggtgggacccct
cttaacaataaagaaaacatggatacaggaactgggctcactccagtcatgacccgagcc
ttaaggagaaagtttcagctggctcatcctcaaagccctactcaatctctgccgctttct
acaagcaactttgatgaacaaaactga

DBGET integrated database retrieval system