KEGG   Rattus norvegicus (rat): 362323Help
Entry
362323            CDS       T01003                                 

Gene name
Sdhaf3, Acn9, LRRGT00092
Definition
(RefSeq) succinate dehydrogenase complex assembly factor 3
Organism
rno  Rattus norvegicus (rat)
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 362323
NCBI-ProteinID: NP_001041379
RGD: 1305143
Ensembl: ENSRNOG00000011283
UniProt: Q6TUF2
Position
4q21
AA seq 111 aa AA seqDB search
MARSGWQKFDCVVVTARGSDTSTLAKDADENRPPSFGSFGGNEITYAAVLWQQAKDSRQS
SSGKACFGTSLPEEKLNDFRDEQIGQLQELMQEATKPNRQFSITESTKPHL
NT seq 336 nt NT seq  +upstreamnt  +downstreamnt
atggcgagatctgggtggcagaagtttgactgtgttgtggtaacagccaggggctctgac
acaagcacactggcaaaagatgcagatgagaacaggccaccttcctttggctcctttgga
ggaaacgagataacatatgcagcagtgttgtggcaacaagctaaggacagcagacaaagt
tcaagcggaaaagcatgctttggcacttctctcccagaagaaaaactcaatgactttcgt
gatgagcaaatcggacagttgcaggagctaatgcaggaagctactaagccgaatcggcag
ttcagtatcaccgagtctacaaaaccacacttgtga

DBGET integrated database retrieval system