KEGG   Rattus norvegicus (rat): 367106
Entry
367106            CDS       T01003                                 

Gene name
Foxb1
Definition
(RefSeq) forkhead box B1
Organism
rno  Rattus norvegicus (rat)
SSDB
Other DBs
NCBI-GeneID: 367106
NCBI-ProteinID: NP_001013266
RGD: 1305217
UniProt: Q5FVH9
Position
8q24
AA seq 215 aa
MVRGWTWRQPPSSAEPRTPQQRLLDPRGGVCHCPHPHSTAEFGLPAGRRTQERRGARGEE
LYRAESKPGWQRVSLVPDSAMQPVPAAYPLPNQLTTMGSSLGTGWPHVYGSAGMIDSATP
ISMASGDYSAYGVPLKPLCHAAGQTLPAIPVPIKPTPAAVPALPALPAPIPTLLSNSPPS
LSPTSSQTATSQSSPATPSETLTSPASALHSVAVH
NT seq 648 nt   +upstreamnt  +downstreamnt
atggttcgagggtggacatggaggcagccacctagctcagcggaaccacgaacgccacag
cagcgtcttctggatccccgaggcggcgtctgccactgtccccacccgcactccacagct
gagttcggcctcccagcaggacgcaggacccaggagcgccgcggagcccgcggagaggag
ctctaccgggctgagtccaagccgggctggcagcgagtctcactggtccccgactctgcc
atgcagccggttccggctgcctacccgctccctaaccagttaactaccatgggcagctct
ctaggcaccggctggccccacgtgtacggttccgcaggtatgatcgactcagccacccca
atctccatggccagtggcgactacagcgcctatggagtgccgctgaagccgctatgccac
gccgcaggccagacgttgcccgccatcccagtgcccatcaagcccactccggccgcagtg
cccgcgctgccagcgctgccggcacccattcctaccctgctctcgaactcgccgccttct
ctcagccccacctcctcgcagacagccactagccaaagcagccctgccacccctagcgag
acactcaccagcccggcctccgccttgcactcggtggccgtgcactga

DBGET integrated database retrieval system