KEGG   Rattus norvegicus (rat): 691051Help
Entry
691051            CDS       T01003                                 

Gene name
Pramef27, Pramel1
Definition
(RefSeq) PRAME family member 27
Organism
rno  Rattus norvegicus (rat)
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 691051
NCBI-ProteinID: NP_001103087
RGD: 1588644
UniProt: D4A203
Position
5q36
AA seq 458 aa AA seqDB search
MSCKTPPVLQELAEDSLLKNQALAVAALDDLPSLFFPSLFKKACRHRLVGIIKAMVQAWP
FPCLPLGAMVSRKTAYRRILEIVLYGFDALLFQEVPHRRCKLKVLDLRVMPLKLWNRLPV
FGTAGCSENPAVLGHSGTRVKQPVKVLVDMVLKESPLDSTEAFLVQWVDSRSGLVKLCCC
KLQIWAMSIYYHRKLLEILDLDSIQELRVYCISNPVCLLNFAPYLGRMRNLRCLILSHLW
QAFSMTPVEKQQVITQFTSQFLKLKCLQILHLDTVFFLEGHLDELFWWLKTPLETLSVID
CNLSKSDWIHISEFQCTSQLKHLNLKWVKLTHLSPEPLRILLLKSASTLISLDLEGCQMM
DSQLSAILPALRCCTQLTKFNFHGNYISMPILRELAHNVVKQKSHPSKIHFIPSCDHHSG
LDFEVISQPHIVFVDVERTTGQQEQVLFYAVCSGEYVL
NT seq 1377 nt NT seq  +upstreamnt  +downstreamnt
atgagctgcaagaccccacctgtactccaggagctggcagaggacagcctcctgaaaaac
caggccttggctgtcgccgctctggatgacctgccctcacttttcttcccgtcgctgttc
aaaaaggcctgcagacacagactggttgggatcatcaaggcgatggtgcaggcttggccc
ttcccctgccttccactgggggccatggtcagtaggaagactgcctaccggagaatctta
gagattgtcctgtatggcttcgatgctttgcttttccaggaagttccccacaggaggtgc
aagctgaaagtgctggatttacgggtcatgcctttgaagctgtggaacaggttgcccgtg
ttcgggactgctggctgtagtgagaatccagcagtgctgggccattcaggaacacgggtg
aaacagccagtgaaggtgctggtagacatggtcctcaaggagagcccgctagattccacg
gaggccttcctcgttcaatgggtagacagcaggagtggtttggtgaagctgtgctgttgc
aagctgcagatctgggcaatgtccatttactaccatcggaaactcttggagatcttggat
ctggactctatccaggagctgcgtgtatactgcatcagcaatcccgtctgcctgctaaac
ttcgccccttacctgggccgcatgaggaacctgcgctgtctcattctctctcacctctgg
caggccttctccatgactccagtggagaagcagcaggtcatcacccagttcacctctcag
ttccttaaactgaaatgcctccagatcctgcatctggacactgtcttcttcctagagggc
catctggatgagctattctggtggctaaagacacccttagagaccctgtcagtgattgat
tgtaatctctcaaaatcagactggatccatatatccgagttccagtgcacaagtcagcta
aaacacctgaatttgaaatgggtcaaactcacccatttgagcccagagcccctgagaatt
ctgttactgaaatctgcatctaccctgatttccctggatttggagggctgtcaaatgatg
gactcccagctcagtgccatcctacctgccctgagatgctgtacacagctcaccaagttt
aatttccacgggaactacatctccatgcctatcctgagggaactggcacataacgtcgtc
aagcagaaatcccacccgtcaaagatccactttatcccaagctgtgatcatcacagtggt
ctggacttcgaagtcatttctcagcctcatattgtgtttgtagatgtggagaggactact
gggcagcaagaacaggtcttgttttatgctgtctgctctggagaatatgtgttgtga

DBGET integrated database retrieval system