KEGG   Rattus norvegicus (rat): 691799
Entry
691799            CDS       T01003                                 

Gene name
Il17d
Definition
(RefSeq) collagen alpha-1(I) chain
  KO
K05492  interleukin 17D
Organism
rno  Rattus norvegicus (rat)
Pathway
rno04060  Cytokine-cytokine receptor interaction
rno04625  C-type lectin receptor signaling pathway
rno04630  JAK-STAT signaling pathway
rno04657  IL-17 signaling pathway
rno04659  Th17 cell differentiation
Brite
KEGG Orthology (KO) [BR:rno00001]
 09130 Environmental Information Processing
  09132 Signal transduction
   04630 JAK-STAT signaling pathway
    691799 (Il17d)
  09133 Signaling molecules and interaction
   04060 Cytokine-cytokine receptor interaction
    691799 (Il17d)
 09150 Organismal Systems
  09151 Immune system
   04625 C-type lectin receptor signaling pathway
    691799 (Il17d)
   04659 Th17 cell differentiation
    691799 (Il17d)
   04657 IL-17 signaling pathway
    691799 (Il17d)
 09180 Brite Hierarchies
  09183 Protein families: signaling and cellular processes
   04052 Cytokines and growth factors [BR:rno04052]
    691799 (Il17d)
Cytokines and growth factors [BR:rno04052]
 Cytokines
  Interleukins
   691799 (Il17d)
SSDB
Other DBs
NCBI-GeneID: 691799
NCBI-ProteinID: XP_038949796
RGD: 1595926
Position
15
AA seq 259 aa
MLGTLVSALEGDRRGHGRGRPGAEGRGGRQDARERRLTGIRSPPRSSPAGTRTRARAPHT
RPPRGLRLWAAAAAGAGGARAGGGPDPGDRAGGGRAGTALGGRPARRPCSGRASRCAERR
AGPATLSAACPAGLDAPRRLPVGTGAGPRGGRAEDREAPGAAAGLRGPAGGAPGAAVRAA
GGRRAQRLPPHAAARAARAGAQCQLPGRGQVRGPPLPAAHQPAQRVALGVQDFLRPRSLS
EIPARSLLPVRGCLTGLLR
NT seq 780 nt   +upstreamnt  +downstreamnt
atgttggggacactggtgagcgccctcgagggggaccggcgagggcatggccgaggccgg
cctggggctgagggacggggaggacggcaggacgcccgggagaggcgtctcacgggcatt
cgcagcccgccgcgcagcagcccggcaggcacacgcacacgtgcacgcgcgccccacacc
cgccccccgcgcgggctccggctctgggcggcggcggcggcgggggccgggggcgcgcgg
gccggcggcgggccggaccccggggaccgcgcgggcggcgggcgggcggggacggcgctc
gggggccggcccgcgcggcgcccatgctcggggagggcctcacggtgtgcggagcgccgg
gcgggtcccgcgacgctgagcgcggcctgtcccgcaggtctggatgctcctcgtcggctt
cctgttggcactggcgccgggccgcgcggcgggcgcgctgaggacagggaggcgcccggc
gcggccgcgggactgcgcggaccggccggaggagctcctggagcagctgtacgggcggct
ggcggccggcgtgctcagcgccttccaccacacgctgcagctcgggccgcgcgagcaggc
gcgcaatgccagctgcccggccgggggcaggtccgcggaccgccgcttccggccgcccac
caacctgcgcagcgtgtcgccctgggcgtacaggatttcctacgaccccgctcgctttcc
gagatacctgcccgaagcctactgcctgtgcgaggctgtctgaccgggctcctacggtga

DBGET integrated database retrieval system