KEGG   Ralstonia pickettii 12D: Rpic12D_R0007
Entry
Rpic12D_R0007     tRNA      T00925                                 

Definition
(GenBank) tRNA-Cys
  KO
K14222  tRNA Cys
Organism
rpf  Ralstonia pickettii 12D
Pathway
rpf00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:rpf00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    Rpic12D_R0007
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:rpf03100]
    Rpic12D_R0007
Non-coding RNAs [BR:rpf03100]
 Transfer RNA
  Rpic12D_R0007
SSDB
Position
1:complement(829205..829280)
NT seq 76 nt   +upstreamnt  +downstreamnt
ggcggggtggcagagtggtcaatgctgcggcttgcaaagccgtataagacggttcaattc
cgttcccccgcctcca

DBGET integrated database retrieval system