KEGG   Rickettsia prowazekii NMRC Madrid E: H374_t220Help
Entry
H374_t220         tRNA      T02544                                 

Definition
(GenBank) tRNA-Val
  KO
K14237  tRNA Val
Organism
rpn  Rickettsia prowazekii NMRC Madrid E
Pathway
rpn00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:rpn00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    H374_t220
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:rpn03100]
    H374_t220
Non-coding RNAs [BR:rpn03100]
 Transfer RNA
  H374_t220
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GeneID: 15150325
Position
complement(649228..649304)
Genome map
NT seq 77 nt NT seq  +upstreamnt  +downstreamnt
gggtgattagctcagttggttagagcattacgttgacatcgtaaaggtcagtggttcgag
tccactatcacccacca

KEGG   Rickettsia prowazekii NMRC Madrid E: H374_t80Help
Entry
H374_t80          tRNA      T02544                                 

Definition
(GenBank) tRNA-Val
  KO
K14237  tRNA Val
Organism
rpn  Rickettsia prowazekii NMRC Madrid E
Pathway
rpn00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:rpn00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    H374_t80
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:rpn03100]
    H374_t80
Non-coding RNAs [BR:rpn03100]
 Transfer RNA
  H374_t80
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GeneID: 15150197
Position
489139..489214
Genome map
NT seq 76 nt NT seq  +upstreamnt  +downstreamnt
gggcgattagctcagttggtagagtatctcgtttacaccgagaatgtcggcggttcgagt
ccgtcatcgcccacca

DBGET integrated database retrieval system