KEGG   Runella slithyformis: Runsl_5228
Entry
Runsl_5228        gene      T01553                                 

Definition
(GenBank) pseudogene
Organism
rsi  Runella slithyformis
SSDB
Position
complement(join(6073703..6074632,6074631..6075092))
NT seq 1392 nt   +upstreamnt  +downstreamnt
atgcgcttcaaaatcggctttttattctctttacttttggttgtttcactgaccaccatt
gctcaacacctgcgccacaaagggagcctgggtataaagtataccgaagtaactgactcg
ttaatgctccggcagcggttacctgacaggcacggtattttggtgaaagacgtaatgcct
gattttacggcggctcgtttggggattcagcccggtgatattctggtttcgatcaatgaa
acggactccctttacctctcggattttcggcaactggagcagcaactctacgaacaggag
ccgatctcaattacgtacattcgaaacagaaaaaaaagccgtgcggttggcagtgtgatg
gccgggcctaaagagtccacccaaggcgaagtcatctatggagaggttccctaccaacgc
ggctttttgcgctccattgttcacaaaccgacgggggggggggggcgctttccggcggta
ttttacattcagggacacgaatgtacctctattgatttctcccatgatccgctgtcgccg
gtcaaaagattgatagatgggtgggtgaatgccgggtacgtcgttttcagggtcgaaaaa
cccggcgtaggcgagagttccggtacaaaagattgcagtaggttgagttacgcggaagaa
ttagccgcttttcaaaatgctttttcatccttccaaaaactttcttttgttgacagtacc
cgtatttacgtatttgggcacgcaatgggcggcaccattgcgcctttactgaccgctcag
tccggttccaaaccaatcggaatgatggtatacggcaccgtagtaaaaccttggtttgaa
catatgctggatgtatttcgtaaacaacccggattggataatgaatcgcttatctccatt
gaggccaacacccgaatggttatgcccctgctgtatgattggctggttcagggcaaaacc
tctacggaacttcttcaggaacccgactatgaggccattcttacttcaaaagagaatcct
ctttcgtatcatcggggtacattttttgggcgtttgccggtttatttttcagaattgcag
caccataatctaacgcaggcgtgggcccaaacggccgtgccgacccttgccatgtatggc
gagtttgacagtcgggccatcagtgcggagtcagcacagagcattgctcagattgtcaat
gaagtgcgccccaatctgggtacctacaaattactaaaagaaacagaccacagtttcagt
aaagtgctgtcctacagcgaatccgttcaatggcagaaatcagggaagtacgcagactat
gcacgaagtcattttaaccctgcaatcattgaggtgaccgttcagtggatgaaacaacag
gaccggaaataa

DBGET integrated database retrieval system