KEGG   Runella slithyformis: Runsl_5284
Entry
Runsl_5284        gene      T01553                                 

Definition
(GenBank) pseudogene
Organism
rsi  Runella slithyformis
SSDB
Position
join(6142646..6142822,6142821..6143138,6143141..6143431,6143431..6143601)
NT seq 957 nt   +upstreamnt  +downstreamnt
atggaaacacagtattttatcggtattgacatctccaaagaaagtttgaattgggcagtt
tgtagttctaataagattatcttagaacatgtttcgggtaatgatataaagagcataacc
aaaactgtaataagcctacaaaggcagttaaattttaaacttggaagtgccgttttgtgc
atggaacacaccgggatttatcacactcgtttattgaaatatctgctgagtcgcaaagct
gcaatttggttggaatcaggtagccaaataaagtactcaatgggcgatgtcagaggcaag
aatgacatcattgatgcccagcgtattgctcgttatgcttataaaaatcgcgatgaaatc
aagctttatgtgcctcccagggctataattgatcaattggacaatctgcttgacattcgt
gacaggttagtaaaagtacgccaaatttgtctgactgccttgaatgagcagaagtcttgt
gaagctaataaaacccacaaaagacacaaaaaatactctgctcatacgctcaaaggagtc
gaaactgatttgcaaaccctcgaaaagcagattaaagaactcattgattctgatcctcag
ctcaaatcactctttgacaacatcacctctattcccggagttggtactgttactgcggct
aaatgtattgtcataacagacgaatttaaaaagttcgagaatgccaaacaactggcttgc
catgccggggttgtaccttttgaaaatagctctggcagcagtttacactcaaagcccaaa
gtcagccaaaaagctcacaaaggaataaaagccaccttatctaattgtgtcatgtcagcc
atgagatataacactcattttaaggcttactatgaacgaaaactcaaagaaggcaaaaac
aagttcaccgtttttaatgccatgaagaacaagctggtcaggcttatttttctttag

DBGET integrated database retrieval system