KEGG   Runella slithyformis: Runsl_R0049
Entry
Runsl_R0049       tRNA      T01553                                 

Definition
(GenBank) tRNA-Gly
  KO
K14225  tRNA Gly
Organism
rsi  Runella slithyformis
Pathway
rsi00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:rsi00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    Runsl_R0049
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:rsi03100]
    Runsl_R0049
Non-coding RNAs [BR:rsi03100]
 Transfer RNA
  Runsl_R0049
SSDB
Position
complement(6032428..6032500)
NT seq 73 nt   +upstreamnt  +downstreamnt
gcgaaagtagctcagctggtagagcgcgaccttgccaaggtcgaggtcgcgggttcgaac
cccgtctttcgct

DBGET integrated database retrieval system