KEGG   Runella slithyformis: Runsl_R0050
Entry
Runsl_R0050       tRNA      T01553                                 

Definition
(GenBank) tRNA-Phe
  KO
K14231  tRNA Phe
Organism
rsi  Runella slithyformis
Pathway
rsi00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:rsi00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    Runsl_R0050
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:rsi03100]
    Runsl_R0050
Non-coding RNAs [BR:rsi03100]
 Transfer RNA
  Runsl_R0050
SSDB
Position
complement(6149488..6149563)
NT seq 76 nt   +upstreamnt  +downstreamnt
ggtgatgtagctcagtcggtagagcaaaggactgaaaatccttgtgtcggcggttcgatt
ccgtccatcaccacct

DBGET integrated database retrieval system