KEGG   Rhodobacter sphaeroides 2.4.1: RSP_3310Help
Entry
RSP_3310          gene      T00284                                 

Definition
(RefSeq) pseudogene
Organism
rsp  Rhodobacter sphaeroides 2.4.1
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GeneID: 3722012
Position
2:370707..371384
Genome map
NT seq 678 nt NT seq  +upstreamnt  +downstreamnt
atgagacaagccctcgtgacaggcggcgccggcctcatcggcgcagggatctgccggacg
ctgcgcgcgcacggctggaaggtggcctccttcgatctcgaggaggcgccggaagccacg
cgctcggtccgctgcgacgtgacggacgaaggatcggtggcgaccgccatggccacgctc
ggctagtccgagttggatctcctcgtgaacaatgcgggacgggccgatccggtcacgggc
cccatcgccgagctcacgctcgccgactggcggcggatgaccgacagtcacctcacagca
gccttcctcatggtgcgggcggcggtgccgctcctgcggcccggcggatccatcgtgaac
atggcttcgacccgcgccttcatgtccgagcccgacacggaggcctatgcggcctccaag
ggcggtctcgtcgcactgacccaggcgctcgcggtgagcctcgggccgcgcctgcgggtg
aatgccatcgcgcccggctggatctctgacggcgacgggctccgggacatcgaccatgcc
cagcatccggcgggccgtgtcggccgcccggaggatgtggccgacacggtgctctggctc
accgacgcgggcttcgtgaccggtcaggtcatcgtcgtggatggcggcatgatgcggaag
atgatctacgcagagtga

DBGET integrated database retrieval system