KEGG   Rhodobacter sphaeroides 2.4.1: RSP_6175Help
Entry
RSP_6175          gene      T00284                                 

Definition
(RefSeq) pseudogene
Organism
rsp  Rhodobacter sphaeroides 2.4.1
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GeneID: 3722017
Position
2:376552..377200
Genome map
NT seq 649 nt NT seq  +upstreamnt  +downstreamnt
ctggttacccgtgatgaaggagcgttccggctccggcacatggctgaagtcgggcaggtt
cgccccatcctcggccgccgccccaaggaggcggagcgccgcgcggatgcagagcacgac
atgctgttcttccgcccgatcatccactggacggccgataacgtgttcggcttcgccgcc
cacaaggggctacggccgaaccctgcaaggcatgagccgcgtgggctgcgccccctgcat
caattccggcaagtccgagctgacggaaatcggccggcgcttccccgaggcggttgccaa
gctgctcgaatgggaggcgctggtgaaggaagccagcaagcgcggagctgcgaccttctt
cgccgccgacgcgatccccgaaggcgcggcgctggcgaagcgcctcaagcggcaggccgc
cgcgtgggtggcgcgcacgcatcccgagctcgacccccacggccgcgagtacaagcgcgc
tatgaaagcccgcatggccgaaatcagcgcggcggccccctggccgcgcgccgacgagtt
attccgctgggcgacgaccgaccgcggcgggcgccagttcagtctcctagagcgcatcgc
ggccgacgaaggcctgtcgtgctccagccagtatggactgtgcgaatga

DBGET integrated database retrieval system