KEGG   Rhodobacter sphaeroides 2.4.1: RSP_6176Help
Entry
RSP_6176          gene      T00284                                 

Definition
(RefSeq) pseudogene
Organism
rsp  Rhodobacter sphaeroides 2.4.1
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GeneID: 3722052
Position
2:418189..418383
Genome map
NT seq 195 nt NT seq  +upstreamnt  +downstreamnt
atgaaggtcatgcaactgaacgagaccggccacttcgtcgggatcgaggaggccgacgag
agcccgctcgagcgcggcgtcttcctgatccccgcaggctgcatcgaggcgccggatccc
gatccgccggcaggctcgcgcgcccgctggaccggggccggatgggtctatgagccgctg
cccgtcggcgtgtag

DBGET integrated database retrieval system